verticale

Ottimizzazione dei processi di digestione anaerobica di matrici ad elevata biodegradabilità

Ottimizzazione dei processi di digestione anaerobica
di matrici caratterizzati da un elevato grado di
biodegradabilità, ossia la frazione organica dei rifiuti solidi
urbani (FORSU) e substrati tipici del settore agroindustriale.

Scarica il PDF Scarica il PDF
Aggiungi ai preferiti Aggiungi ai preferiti


Articoli tecnico scientifici o articoli contenenti case history
Tesi di Dottorato, Università Cà Foscari Venezia, Anno Accademico 2012-2013

Pubblicato
da Alessia De Giosa
VerticaleSegui aziendaSegui




Settori: 

Parole chiave: 


Estratto del testo

Scuola Dottorale di Ateneo
Graduate School
Scienze e Tecnologie

Dottorato di ricerca
in Scienze Ambientali
Ciclo XXV
Anno di discussione: 2013


Titolo ''Ottimizzazione dei processi di digestione anaerobica di matrici ad elevata biodegradabilità'' Tematica Risparmio energetico e micro-generazione distribuita



SETTORE SCIENTIFICO DISCIPLINARE DI AFFERENZA: ING-IND/25
Tesi di Dottorato di: Antonio Giuliano; Matricola: 955760




Coordinatore del Dottorato Tutor
Prof. Bruno Pavoni Prof. Paolo Pavan























































''Non è un eroe né un martire, solo un ragazzo che credeva nei diritti umani. Eravamo lontani, ma più che mai vicini. Come ora, con la sua presenza viva che ingigantisce di ora in ora, come un vento che da Gaza, dal suo amato mar Mediterraneo, soffiando impetuoso ci consegni le sue speranze e il suo amore per i senza voce, per i deboli, per gli oppressi, passando il testimone' Stay Human Egidia Beretta Arrigoni in ricordo del figlio Vittorio Arrigoni
'a cui dedico questo mio lavoro.














Prefazione


La presente tesi di dottorato ha avuto come oggetto di studio l''ottimizzazione dei processi di digestione anaerobica di matrici caratterizzati da un elevato grado di biodegradabilità, ossia la frazione organica dei rifiuti solidi urbani (FORSU) e substrati tipici del settore agroindustriale. L''attività stata svolta nell''ambito della tematica ''Risparmio energetico e microgenerazione distribuita''. Il finanziamento della borsa di studio è stato messo a disposizione dal Ministero dell''Istruzione, dell''Università e della Ricerca (MIUR) e attraverso il fondo per il sostegno ai giovani ricercatori. L''intera sperimentazione è stata condotta presso il depuratore comunale di Treviso dove è presente la stazione sperimentale del dipartimento di Scienze Ambientali dell'' Università Cà Foscari di Venezia e del dipartimento di Biotecnologie dell''Università degli studi di Verona, che fanno parte del Consorzio Interunivesitario Nazionale '' La Chimica per l''Ambiente'' (INCA). L''attività di ricerca inerente l''ottimizzazione dei processi di digestione anaerobica della FORSU è stata condotta all''interno del progetto VALORGAS (Valorization of food waste to biogas) finanziato dalla Comunità Europea nell''ambito del settimo programma quadro (FP7). Mentre l''attività condotta nel settore agroindustriale è stata finanziata dalla Regione Veneto nell''ambito del progetto RiduCaReflui di Veneto Agricoltura, l''azienda regionale per il settore agricolo, forestale e agroalimentare. Nel corso di questi tre anni l''attività di studio ha prodotto diverse pubblicazioni sia su riviste scientifiche internazionali ad indice di impatto che su riviste nazionali consentendo inoltre la partecipazione a diversi convegni e work shops.













Pubblicazioni
Antonio Giuliano, David Bolzonella, Cristina Cavinato, Paolo Pavan, Franco Cecchi. (2013)
SS-OFMSW sorting approaches oriented to anaerobic digestion: comparison for full scale
implementation. Submitted on Waste Managment.

Antonio Giuliano, David Bolzonella, Paolo Pavan, Cristina Cavinato, Franco Cecchi (2013)
.
Co-digestion of livestock effluents, energy crops and agro-waste: Feeding and process optimization
in mesophilic and thermophilic conditions. Bioresource Technology 128 (2013) 612''618.

Cristina Cavinato, Antonio Giuliano, David Bolzonella, Paolo Pavan, Franco Cecchi (2012).
Bio-hythane production from food waste by dark fermentation coupled with anaerobic digestion
process: A long-term pilot scale experience. International Journal of Hydrogen Energy Volume 37,
Issue 15, August 2012, Pages 11549''11555

David Bolzonella,Francesco Fatone, Cristina Cavinato, Paolo Pavan, Silvia Di Fabio, Nicola
Frison, Antonio Giuliano,
Elisa Nota, Letizia Zanetti, Franco Cecchi (2012). Monitoraggio
della codigestione anaerobica di effluenti e substrati. Terra e Via n. 4/2012.

Cristina Cavinato, David Bolzonella, Francesco Fatone, Antonio Giuliano, Paolo Pavan
(2011).
Two-phase thermophilic anaerobic digestion process for biohythane production treating
biowaste: preliminary results. Water Science & Technology 64. 3 2011

Atti di convegno
Letizia Zanetti, Antonio Giuliano, David Bolzonella, Federico Micolucci, Cristina Cavinato,
Paolo Pavan (2013)
Termophilic two phase anaerobic digestion of SS-OFMSW for bio-hythane
production: effect of recirculation sludge and microbiology in a long-term pilote scale experience.
Word Congress on Anaerobic Digestion IWA Conferences Santiago de Compostela June 25-28
2013

Antonio Giuliano, David Bolzonella,Cristina Cavinato, Paolo Pavan, Franco Cecchi (2012)
Ottimizzazione e valutazione della stabilità a lungo termine del processo di produzione di Bio-
hythane mediante digestione anareobica della FORSU. Ecomondo Rimini Fiera 6-9 novembre 2013
Antonio Giuliano, Cristina Cavinato, David Bolzonella, Paolo Pavan, Franco Cecchi
(2011)
SS-OFMSW approaches oriented to anaerobic digestion: preliminary comparison for full scale
implementation.X DAAL, X Oficina e Simpòsio Latino Americano de Digestao Anaerobia. Ouro
Preto '' Minas Gerais Brasil 23/27 Outubro de 2011. IWA Specialist Conference

Antonio Giuliano (2011).
Optimization of two phase termophilic anaerobic digestion process of
food waste for H2 and CH4 production through reject water recirculation. Jeux Olympo
Scientifiques Narbonne 22-23 Settembre 2011 INRA

Giuliano Antonio. Cristiona Cavinato, David Bolzonella, Paolo Pavan (2010) .
Produzione di
idrogeno e metano attraverso la digestione anaerobica a due fasi di rifiuti organici ad elevata
biodegradabilità 3°Festival dell''Energia (LECCE 20-23 Maggio 2010). Riassunto

Oggetto della presente tesi i dottorato è stato lo l''ottimizzazioni del processo digestione anaerobica a partire da matrici ad elevata biodegradabilità. In modo particolare sono state condotte tre attività distinte: - Ottimizzazione del processo di produzione di bio-hythane a partire dalla FORSU mediante un approccio di digestione anaerobica a doppia fase separata e controllato attraverso il ricircolo tra una fase a l''altra - Confronto tra diversi sistemi di pretrattamento meccanici della FORSU - Ottimizzazione del processo di co-digestione anaerobica di matrici tipici del settore zootecnico e agroindusriale ( effluenti d''allevamento, colture dedicate e residui vegetali agroindustriali) Ottimizzazione del processo di produzione di bio-hythane. In modo del tutto analogo allo schema evidenziato nella figura 0, uno degli obiettivi è stato quello di sviluppare in reattori CSTR su scala pilota di grossa taglia, un processo di digestione anaerobica termofilo a doppia fase separata ( dark fermentation e metanogenesi) utilizzando come substrato di partenza la frazione organica dei rifiuti solidi urbani (FORSU). Il processo di ottimizzazione era mirato allo sviluppo di un processo continuo di produzione di biogas arricchito con una quota di H2 pari al 5-15% del volume totale del gas prodotto. La misela così ottenuta prende il nome di bio-hythane la quale a seguito del processo di combustione comporta dei vantaggi rispetto al classico biogas sia dal punto di vista ambientale che motoristico. L''analisi critica della letteratura ha evidenziato una discordanza di opinioni in merito al carico organico ottimale per la produzione di bio-hythane. Per tanto nella prima fase di studio sono stati condotti tre RUNs sperimentali caratterizzati da tre differenti carici organici al fine di definire quello ottimale in riferimento alle qualità e alla quantità della miscela totale di gas prodotta. Figura 0: lay out di processo adottato per la produzione di bio-hythane La strategia di ottimizzazione inoltre ha previsto l''applicazione del ricircolo in testa processo della frazione liquida dell''effluente del reattore di metanogenesi con l''obiettivo primario di sfruttare la sua capacità tamponante ed evitare quindi di ricorrere all''utilizzo di un buffer esterno al processo necessario a tamponare il pH intorno al valore ottimale per la produzione di idrogeno (5.5) nella fase di dark fermantation. Tale approccio ha consentito di annullare l''apporto di alcalinità esterna quindi riducendo i costi di gestione. D''altro canto l''accumulo di ammoniaca nei due reattori dovuto al continuo ricircolo ha portato a fenomeni di sbilanciamento della catena trofica. Per tanto nella seconda fase di studio è stato testato un lungo periodo d''esercizio in cui è stato valutato l''effetto della variazione del ricircolo sulla stabilità del processo. I risultati relativi al secondo periodo sperimentale hanno dato ottimi risultati in termini di rese di conversione e la produzione di idrogeno si è rivelata in linea con le necessità di formare una miscela gassosa di interesse industriale per un lungo periodo d''esercizio. Inoltre le correlazioni tra diversi paramentri facilmente misurabili mediante un sistema di sonde a basso costo ha aperto la strada a possibili implementazioni di controllo automatico del processo. Confronto tra diversi sistemi di pretrattamento della FORSU. Un secondo obiettivo della tesi è stato quello di confrontare diversi sistemi di pretrattamento meccanico della frazione organica dei rifiuti solidi urbani necessari per ridurre la quota di materiale inerte da inviare alla successiva sezione di stabilizzazione anaerobica. La necessità di tale sperimentazione deriva dal fatto che i sistemi di pretrattamento installati nella maggior parte degli impianti di digestione anaerobica della FORSU sono stati concepiti in tempi in cui la raccolta differenziata non aveva raggiunto i livelli odierni di efficienza. Per tanto, dovendo trattare flussi più eterogenei ad alto contenuto di materiale inerte, tali sistemi sono spesso caratterizzati da tecnologie ad elevato consumo specifico dotati inoltre di scarsa efficienza nell''intercettare materiale inerte non idoneo al processo di digestione. L''attività di studio condotta ha visto il confronto qualitativo dei flussi generati da 4 sistemi di pretrattamento della FORSU tra i più diffusi sul mercato: hydropulper, pressa d''estruzione, selezione gravitazionale ad umido e mulino a coltelli accoppiato ad un vaglio fisso. I risultati sperimentali hanno evidenziato che la tecnologia della pressa d''estrusioe porta ad una maggiore efficienza di separazione. Inoltre l''hydropulper genera un maggiore quantitativo di sabbie nei flussi a valle del sistema di pretrattamento. Ottimizzazione dei processi i co-digestione anaerobica nel settore zootecnico. Infine per quanto riguarda il settore zootecnico è stata condotta un'' attività di ricerca mirata all''ottimizzazione dei processi di co-digestione anaerobica di effluenti d''allevamento con matrici tipiche del settore agroinustriale (effluenti d''allevamento bovino, insilato di mais e scarti vegetali agroaliemtari). La sperimentazione che ha visto l''impiego in parallelo di quattro reattori (CSTR) di grossa taglia mantenuti in parellelo in diverse condizioni operative, ha avuto lo scopo di definire le migliori condizioni d''esercizio in termini di temperatura, carico organico, tempo di residenza idraulico e substrato di partenza. In particolare sono stati condotti tre RUNs sperimentali caratterizzati da tre diverse miscele di partenza: effluenti d''allevamento bovino; effluenti d''allevamento bovino ed insilato di mais; effluenti d''allevamento bovino, insilato di mais e sottoprodotti vegetali dell''industria agroalimentare. I risultati sperimentali hanno evidenziato che il regime termico termofilo (55°) porta alle rese più interessanti rispetto a quello mesofilo (37°) quando si opera in regime di codigestione, mentre nel caso del trattamento di soli effluenti d''allevamento il processo termofilo manifesta una certa sofferenza nel portare a termine le reazioni della catena trofica anaerobica per via dell''effetto inibente esercitato dall''ammoniaca. In tutte le condizioni sperimentali testate è stato messo alla luce che è possibile incrementare il carico dei reattori di circa il doppio rispetto a quelli adottati negli impianti attualmente in esecizio dimezzando allo stesso tempo i tempi di residenza. Per gli impianti di nuova progettazione questo si traduce nella possibilità di dimezzare le volumentrie quindi ridurre i costi di investimento.





















Sommario
1.
Introduzione ............................................................................................................................................. 1 1.1 Scenario energetico: le biomasse come fonte energetica rinnovabile ............................................... 1 1.2 La Digestione Anaerobica ................................................................................................................... 4 1.3 Substrati tipici della digestione anaerobica ...................................................................................... 12 2. Strategie per l''ottimizzazione dei processi di digestione anaerobica ............................................... 17 2.1 Idrogeno e Idrometano.......................................................................................................................... 17 2.2 La dark fermentation e il bio-hythane .................................................................................................. 20 2.3 Pre-trattamenti meccanici della frazione organica dei rifiuti solidi urbani .................................. 30 2.4 Processi di digestione anerobica di substrati agroindustriali ........................................................ 39 3. Finalità della ricerca .............................................................................................................................. 45 4. Materiali e metodi .................................................................................................................................. 48 4.1 Metodi per la Produzione di Bio-hythane. ....................................................................................... 48 4.1.1 Reattori ed inoculo............................................................................................................................. 48 4.1.2 Substrati e alimentazione ................................................................................................................... 50 4.1.3 Condizioni operative ......................................................................................................................... 51 4.1.4 Test di evaporazione .......................................................................................................................... 53 4.1.5 Analisi molecolare (PCR-DGGE) ..................................................................................................... 54 4.1.6 Analisi delle popolazione batterica mediante FISH .................................................................... 62 4.2 Metodi per il confronto dei sistemi di pretrattamento della FORSU ............................................ 65 4.3 Materiali e metodi per la processo di co-digestione di matrici agroindustriali............................. 69 4.3.1 Reattori e condizioni operative .......................................................................................................... 69 4.3.2 Substrati ed inoculo ........................................................................................................................... 70 5. Risultati e discussione ............................................................................................................................ 73 5.1 Produzione di Biohythane: confronto tra i diversi carichi organici .......................................................... 73 5.1.1 RUN1 ................................................................................................................................................ 73 5.1.2: RUN 2.............................................................................................................................................. 79 5.1.3: RUN 3.............................................................................................................................................. 87 5.1.4: RUN 4.............................................................................................................................................. 98 5.2 Ottimizzazione dei processi di co-digestione anaerobica di effluenti d''allevamento, energy crops e
sottoprodotti agroalimentari. ..................................................................................................................... 116
5.2.1 Digestione anaerobica di soli effluenti d''allevamento di origine bovina ........................................ 116 5.2.2 Co-digestione anaerobica di effluenti d''allevamento ed energy crops. ........................................... 127 5.2.3 Co-dogestione di effluenti d''allevamento, energy crops e sottoprodotti agroalimentari. ............. 135 5.3 Confronto di diversi sistemi di pretrattamento meccanico della FORSU ........................................ 145 6 Conclusioni ........................................................................................................................................... 152 Bibliografia ................................................................................................................................................... 156
Indice delle Figure e Tabelle

Tabella 1: Consumo di energia primaria ............................................................................................. 1
Tabella 2: Intervalli di temperatura ottimali di alcune classi di microrganismi metanigeni ................ 7
Tabella 3: Caratteristiche e potenziale in biogas dei liquami ........................................................... 15
Tabella 4: Rese e produzione di biogas da colture specifiche ........................................................... 16
Tabella 5: Caratteristiche dell''idrogeno molecolare come carburante ............................................. 17
Tabella 6: Numero impianti e tipologia di substrato trattato in Italia ................................................ 39
Tabella 7: caratteristiche degli inoculi (produzione di biohythane). ................................................. 49
Tabella 8: Caratterizzazione della FORSU (prima fase sperimentale) ............................................ 50
Tabella 9: Caratterizzazione della FORSU (seconda fase sperimentale) ........................................ 51
Tabella 10: Condizioni operative per il processo di produzione di biohythane ................................. 52
Tabella 11: Sonde oligonucleotidiche (FISH) ................................................................................... 64
Tabella 12: Tecnologie di pretrattamento e tecnniche di raccolta della FORSU. .............................. 65
Tabella 13: Dimensione dei setacci adottati nell''analisi granulometrica ......................................... 68
Tabella 14: Condizioni operative dei reattori impiegati per trattamento di matrici agroindustriali .. 69
Tabella 15: Caratterizzazione dei substrati agroindustriali impiegati ............................................... 70
Tabella 16: Costanti di idrolisi e SGP dei diversi substrati agroindustriali impiegati ...................... 71
Tabella 17: caratterizzazione dell''inoculo dei reattori (ottimizzazioni substrati agroindustria)........ 72
Tabella 18: Valori medi e deviazione standard del RUN 1 (produzione di biohythane) ................... 77
Tabella 19: Bilanci di massa nel RUN1 (produzione di biohythane) ................................................ 78
Tabella 20: Valori medi durante il RUN 2. (produzione di biohythane) ........................................... 83
Tabella 21: bilancio di massa del RUN 2 (produzione di biohythane) .............................................. 84
Tabella 22: valori medi urante il RUN 3 (produzione di biohythane) ............................................... 91
Tabella 23: bilanci di massa del RUN 3 (produzione di biohythane) ................................................ 93
Tabella 24: Rese specifiche di gas in funzione dell''OLR medio.(produzione di biohythane) ......... 93
Tabella 25: Composizione del biohythane ......................................................................................... 96
Tabella 26: condizioni operative nel RUN 4 (produzione di biohythane) ......................................... 98
Tabella 27: risultati del sequenziamento RUN4A.(produzione di biohythane) ............................... 105
Tabella 28: valori medi registati nelle CSS del RUN 4C.(produzione di biohythane) .................... 107
Tabella 29: Bilanci di massa del RUN 4 C. (produzione di biohythane) ......................................... 107
Tabella 30: bilancio del gas totale prodotto durante i RUN 4C (produzione di biohythane). ......... 109
Tabella 31: test di evaporazione: 4 ore di trattamento ..................................................................... 114
Tabella 32: test di evaporazione 1 ora di trattamento ...................................................................... 114
Tabella 33: Condizioni operative (agroindustria) ............................................................................ 116
Tabella 34: valori medi registrati dai reattori mesofili nell RUN1 (effluenti d''allevamento) ......... 122
Tabella 35:Bilanci di massa nei reattori mesofili (trattamento effluenti d''allevamento) ................ 123
Tabella 36: valori medi registrati dai reattori termofili RUN1 (effluenti d''allevamento). ............. 125
Tabella 37: caratteristiche effluenti negli ultimi giorni di esercizio in mesofilia (effluenti
d''allevamento). ................................................................................................................................ 126
Tabella 38: Condizioni operative previste nel RUN 2 (reflui zootecnici ed energy crops) ............. 127
Tabella 39: Valori medi riscontrati nel trattamento di effluenti d''allevamento ed energy crops .... 132 Tabella 40: Bilanci di massa nel RUN 2 ( co-digestione effluenti d''allevamento e energy crops). 134
Tabella 41: Valori medi nel RUN 3 (effluenti d''allevamento+energy crops+residui vegetali) ..... 138
Tabella 42: Bilanci di massa del RUN 3 (effluenti d''allevamento+energy crops+residui vegetali)140
Tabella 43: produzione specifiche teoriche e ottenute nel trattamento di reflui agroindustriali ...... 143
Tabella 44: Tipologia di pretrattamenti e rispettive strategie di raccolta differenziata. ................. 145
Tabella 45: analisi merceologica dei rifiuti in ingresso ai pretrattamenti. ....................................... 145
Tabella 46: Concentrazione di TS e TVS per classe merceologica dei flussi in ingresso ai
pretrattamenti ................................................................................................................................... 146
Tabella 47: classificazione merceologica del flusso di scarto dalla linea di pretrattamento ........... 147
Tabella 48: Contenuto di TS e TVS del flusso di scarti dei pretrattamenti ..................................... 148
Tabella 49: caratteristiche chimico-fisiche dei flussi in uscita dai pretrattamenti. .......................... 149
Tabella 50: distribuzione granulomentrica dei flussi in uscita dai pretrattamenti ........................... 150
Tabella 51: Condizioni operative ottimali per la produzione di bio-hythane .................................. 152

Figura 1: Approvvigionamento energetico in Italia suddiviso per fonte ............................................ 2
Figura 2: Schema semplificato della digestione anaerobica ............................................................... 5
Figura 3: Configurazioni reattoristiche ............................................................................................. 10
Figura 4: Vie metaboliche nella dark fermentation ......................................................................... 21
Figura 5: Configurazione a doppia fase per la produzione accoppiata di H2 e CH4 ......................... 26
Figura 6: Andamento della velocità di produzione di idrogeno in funzione dell''HRT .................... 27
Figura 7: Idropolpatori per il trattamento della FORSU ................................................................... 34
Figura 8 : Presso estrusore ................................................................................................................. 35
Figura 9: Screw Press ........................................................................................................................ 35
Figura 10:Disc Screen ........................................................................................................................ 36
Figura 11:Wet Selection..................................................................................................................... 37
Figura 12: Impianti di Digestione Anaerobia Agricoli e Potenza Installata in Italia. ...................... 40
Figura 13: Tecnologia Bekon. ............................................................................................................ 41
Figura 14. Processo Linde .................................................................................................................. 41
Figura 15: Schema di processo Schmak ............................................................................................ 42
Figura 16: Processo LIPP ................................................................................................................... 43
Figura 17: schema di processo a due fasi di digestione anaerobica per impianti agroindustriali ...... 43
Figura 18: Schema di processo per la produzione accoppiata H2 (via dark fermentation) e CH4 ... 45
Figura 19: reattori impiegati per la produzione di bio-hythane ......................................................... 48
Figura 20: Schema di processo adottato adottao per la produzione di biohythane ............................ 51
Figura 21: Fasi principali dell''analisi FISH ...................................................................................... 62
Figura 22: Reattori impiegati per il trattamento di matrici agroindustriali ........................................ 69
Figura 23: Profilo temporale dei VFA nella Dark Fermentation.(RUN1) ........................................ 73
Figura 24: concentrazione di H2 nel gas in uscita dal reattore della dark fermentation (RUN1) ...... 74
Figura 25: pH e percentuale di idrogeno nel rattore della dark fermentation.(RUN1) .................... 74
Figura 26: alcalinità totale e parziale nel reattore della metanogenesi (RUN1). ............................... 75
Figura 27: Profili temporali dei VFA e del pH nel reattore di metanogenesi (RUN1). ..................... 75
Figura 28: Profilo temporale della concentrazione di N-NH4 + (RUN1) ............................................ 76 Figura 29: RUN I, Dark fermentation: percentuale e produzione specifica di idrogeno ................. 76
Figura 30: Distribuzione azoto nel flusso in entrata e in uscita nel RUN 1 ....................................... 78 Figura 31: Produzione di VFA durante il RUN 2 (dark fermentation) .............................................. 79
Figura 32: Produzione specifica di idrogeno RUN 2(dark fermentation) .......................................... 80
Figura 33: percentuale di idrogeno RUN2 (dark fermentation) ........................................................ 80
Figura 34: velocità di produzione di gas RUN2 (dark fermentation) ................................................ 80
Figura 35: Profilo temporale del pH nei due reattori (RUN2) ........................................................... 81
Figura 36: andamento dell''alcalinità totale e parziale del flusso di ricircolo (RUN2). .................... 81
Figura 37: profilo temporale dei VFA nel reattore di metanogenesi (RUN2) ................................... 82
Figura 38: Profilo temporale dell''ammoniaca (RUN2) ..................................................................... 85
Figura 39: Profilo temporale del NH3 e dell''acido propionico RUN 2( metanogenesi) ................... 85
Figura 40: Andamento dei VFA durante il RUN3 nel reattore della dark fermentation. .................. 87
Figura 41 : composizione del gas in uscita dalla dark fermentation durante il RUN 3. .................... 87
Figura 42: Profilo temporale del pH nel reattore della dark fermentation durante il RUN 3 ............ 88
Figura 43: Profilo temporale dei VFA nel reattore di metanogenesi durante il RUN 3. ................... 89
Figura 44: Profilo temprale del pH durante il RUN 3 (metanogenesi). ............................................. 89
Figura 45: Profilo temporale dell''alcalinità durante il RUN 3(metanogenesi) ................................. 90
Figura 46: Profilo temporale dell''azoto ammoniacale (RUN3) ......................................................... 90
Figura 47:Andamento della produzione specifica di idrogeno in funzione del carico organico ....... 94
Figura 48: correlazione tra pH e produzione di idrogeno (dark fermentation) .................................. 95
Figura 49: correlazione tra alcalinità totale (metanogenesi) e pH (dark fermentation). .................... 95
Figura 50: correlazione tra amoniaca e alcalinità (metanogenesi) ..................................................... 96
Figura 51: profilo temporale dell''ammoniaca durante il RUN 4 ....................................................... 99
Figura 52: profilo temporale dei VFA nel RUN 4 (metanogenesi) ................................................. 100
Figura 53: Profilo temporale dell''alcalinità durante il RUN 4 ........................................................ 100
Figura 54: Profilo temporale del pH durante il RUN 4.................................................................... 101
Figura 55: SGPe composizione del biogas nel reattore di metanogenesi (RUN4) .......................... 102
Figura 56: SGP e GPR nella dark fermentation (RUN4) ................................................................. 102
Figura 57: composizione del gas nel reattore della dark fermentation (RUN4) .............................. 103
Figura 58: profilo delle bande ottenuto mediante PCR-DGGE. ...................................................... 105
Figura 59: Analisi molecolare FISH effettuata nel reattore della dark fermentation ....................... 106
Figura 60: composizione del gas totale prodotto durante il RUN 4................................................. 108
Figura 61: Schema di processo proposto per l''implementazione in piena scala (bio-hythane) ....... 110
Figura 62: Conducibilità in funzione dell''ammonica. ..................................................................... 111
Figura 63: VFA Vs Conducibilità .................................................................................................... 111
Figura 64: conducibilità VS alcalinità totale .................................................................................... 112
Figura 65: conducibilità Vs differenza tra alcalinità totale e parziale ............................................. 112
Figura 66: test di rimozione dell''azoto ammoniacale mediante evaporazione ................................ 113
Figura 67: pH e produzione di idrogeno (LAB SCALE) ............................................................... 115
Figura 68: pH durante il trattamento di effluenti bovini. ................................................................ 117
Figura 69: alcalinità durante le fasi di start-up e RUN 1 (effluenti d''allevamento) ........................ 118
Figura 70: VFA durante le fasi di start-up e RUN 1 (effluenti d''allevamento) .............................. 118
Figura 71: composizione del biogas durante lo start-up e RUN 1 (effluenti d''allevamento) ......... 120
Figura 72: SGP durante le fasi di start-up e RUN 1 (effluenti d''allevamento) .............................. 121
Figura 73: GPR nei reattori termofili durante il RUN 1(effluentid''allevamento). .......................... 124
Figura 74: azoto totale nei flussi in entrata e in uscita dai reattori (effluentid''allevamento) .......... 126 Figura 75: alcalinità durante il RUN 2 (effluenti d''allevamento+energy crops) ............................. 128
Figura 76: pH nel RUN 2 (effluenti d''allevamento+energy crops) ................................................. 129
Figura 77: VFA nel RUN 2 (effluenti d''allevamento+energy crops) .............................................. 129
Figura 78: ammoniaca durante il RUN 2 (effluenti d''allevamento+energy crops) ......................... 130
Figura 79: produzione di biogas durante il RUN 2 (effluenti d''allevamento+energy crops) ........ 131
Figura 80: distribuzione azoto nei 4 reattori (RUN 2) (effluenti d''allevamento+energy crops) ..... 134
Figura 81: pH (effluenti d''allevamento+energy crops+ residui vegetali)....................................... 135
Figura 82: alcalinità(effluenti d''allevamento+energy crops+ residui vegetali) ............................... 136
Figura 83: VFA (effluenti d''allevamento+energy crops+ residui vegetali) .................................... 136
Figura 84: composizione del biogas (effluenti d''allevamento+energy crops+ residui vegetali) ..... 137
Figura 85: SGP durante il RUN 3) (effluenti d''allevamento+energy crops+ residui vegetali) ....... 137
Figura 86: azoto nei 4 reattori (effluenti d''allevamento+energy crops+ residui vegetali) .............. 140
Figura 87: acidi grassi volatili Vs ammoniaca libera nei reattori termofili (agroindustria) ............ 142
Figura 88: frazione di azoto ammoniacale durante il trattamento di reflui agroindustriali ............. 144
Figura 89: distribuzione dei TS e VS nel flusso in uscita dai pretrattamenti della FORSU ............ 151













































Lista acronimi

Ac: acido acetico; AD: digestione anaerobica ASBR: anaerobic sequencing batch reactor; AV: valore medio AW: agro waste (residui agroalimentari); Bu: acido butirrico; CSTR: continuous stirred-tank reactor; CRPA: centro ricerche produzioni animali; CDR: combustibile derivato dai rifiuti; COD: chemical oxygen demand; DGGE: Denaturing Gradient Gel Electrophoresis; DS: deviazione standard; ENI: ente nazionale idrocarburi; ENEA: Agenzia Nazonale per le nuove tecnologie, l''energia e lo sviluppo economico sostenibile; EC: energy crops; EA: effluenti d''allevamento; FER: fonti energetiche rinnovabili; FORSU: frazione organica dei rifiuti solidi urbani; FOP: frazione organica putrescibile; FBR: fluized beb reactor; GPR: gas production rate; GP: gas production; HRT: tempo di residenza idraulico; HCNC: hydrogen combined natural gas; HPR: hydrogen production rate IEA: International Energy Agency; Kh: costante di idrolisi LCA: Life Cicle Assessment; NH3: ammoniaca libera; N-NH4: azoto ammoniacale OCSE: Organisation for Economic Co-operation and Development; OHPA: acetogeni produttori obbligati di idrogeno; OLR: organic load rate;P: fosforo; PA: alcalinità parziale PFR: plug flow reactor; Qr: portata di ricircolo Qt: portata totale; RSU: rifiuti solidi urbani; SGP: specific gas production; SHP: specific hydrogen production SRT: sludge retention time; T: temperatura; TA: alcalinità totale; TKN: total Kjiendhal nitrogen TPE: tonnellate di petrolio equivalente; TS: solidi totali; TVS: solidi totali volatili UASB: Upflow anaerobic sludge blanket reactor; V: volume VFA: volatile fatty acid; WWTP: waste water tratment plant; W.W: wet weight; d.w: dry weight.









1 1. Introduzione 1.1 Scenario energetico: le biomasse come fonte energetica rinnovabile
Il progressivo depauperamento delle riserve mondiali di combustibili fossili crea la necessità di trovare fonti di energia alternative. Secondo l''International Energy Agency (IEA) attualmente il consumo mondiale di energia primaria ha superato ampliamente i 10 miliardi di tonnellate di petrolio equivalente (Tabella 1) segnando negli ultimi anni una contrazione del suo incremento dovuto all''impatto della crisi economica, riflettendosi essenzialmente in una riduzione del consumo di petrolio nei paesi dell''OCSE. Tabella 1: Consumo di energia primaria in tonnellate di petrolio equivalente (TPE) Fonte energetica Consumo in TEP Petrolio 4,01 (35,2%) Carbone 2,80 (24,5%) Gas Naturale 2,36 (20,7 %) Nucleare 0,73 (6,4%) Idroelettrico 0,25 (2,2%) Altre rinnovabili (1) 1,25 (11,0%) Totale 11,40 (100%) FONTE: ENI., 2008. Elaborazione su dati IEA. Il petrolio risulta essere al primo posto come contributo al soddisfacimento della domanda di energia primaria mondiale, con una quota pari di circa il 35%, seguito dal carbone (24.5%), gas naturale (20.7%) e nucleare (6.4%). L''apporto delle energie rinnovabili al consumo mondiale di energia primaria è del 12.8%, con un tasso medio annuo di crescita del 2%. Tale contributo se lo si rapporta alla produzione di energia elettrica mondiale corrisponde al 18.5%. di cui gran parte proviene dal settore idroelettrico (dati riferiti al 2008). Un aspetto molto importante da considerare è che dal 2008 in poi l''Unione Europea, grazie alle politiche incentivanti la produzione di energia da fonti rinnovabili, in relazione a quest''ultime ha fatto registrare un incremento del 50% della nuova capacità installata superando quella delle fonti tradizionali. 2 A livello nazionale, il 12.2% della domanda energetica deriva da fonti rinnovabili (FER) mentre rispetto alla produzione totale di energia elettrica da FER , il 67% è attribuibile all'idroelettrica e solo il 12 % alle biomasse (Figura 1). Figura 1: Approvvigionamento energetico in Italia suddiviso per fonte (sinistra) e produzione di
energia elettrica da fonte rinnovabile (destra). Fonte: ENEA 2010
Per quanto riguarda l''aspetto ambientale, nonostante gli sforzi degli ultimi anni l''Italia risulta al terzo posto in EU27 per le emissioni prodotte dopo Germania e Gran Bretagna (Cortesi, 2010). Per tanto è necessario prevedere degli interventi che favoriscano ancora di più lo sviluppo di tecnologie innovative al fine di raggiungere gli obiettivi fissati dai protocolli di intesa in materia ambientale (protocollo di Kyoto). Il recente piano di azione dell''Unione Europea per l''efficienza energetica, con il cosiddetto principio ''20-20-20'', ha fissato i termini di una concreta monetizzazione dei flussi di anidride carbonica proponendosi entro il 2020 di ridurre le emissioni che il consumo energetico del 20% e nello stesso tempo di aumentare la quota di energia da fonti rinnovabili del 20% sul consumo energetico totale. Alla luce di ciò è evidente il ruolo centrale che giocheranno le biomasse nel soddisfacimento della domanda complessiva di energia primaria. L''impiego delle biomasse come fonte energetica in sostituzione delle tradizionali fonti fossili comporta molteplici vantaggi. Provenendo direttamente o indirettamente dai processi fotosintetici le biomasse rappresentano una fonte di energia praticamente inesauribile e, in linea di principio, la quota di anidride carbonica immessa nell''atmosfera corrisponde a quella fissata durante la fase di fotosintesi promuovendo così, in caso di combustione completa, flussi netti di gas serra nulli. Inoltre le biomasse si prestano facilmente ad essere sottoposte a processi di trasformazione biologica, energeticamente più sostenibili rispetto a quelli tradizionali. Nonostante ciò in assenza di una politica incentivante la convenienza economica rispetto ai processi di approvvigionamento energetico tradizionale non è del tutto netta ed evidente. Sul piano energetico tra le varie applicazioni dei processi di trasformazione chimico-fisici e/o biologici della biomassa, vi è la produzione di biocarburanti che , oltre a prestarsi per la produzione di calore e/o energia elettrica, possono essere utilizzati nel settore dell''autotrazione o miscelati con i 3 carburanti provenienti da combustibili fossili e, in alcuni casi, impiegati allo stato puro. I biocarburanti possono essere sia allo stato liquido (biodiesel, bioetanolo, ecc.) che in forma gassosa (biogas, bio-metano, bio-idrogeno ecc.). In genere, l''impiego di carburanti liquidi semplifica notevolmente le fasi di trasporto e di distribuzione, mentre esiste un''intrinseca difficoltà a creare una rete di punti vendita per i carburanti gassosi che sia adeguatamente distribuita sul territorio. Pertanto, ai biocarburanti liquidi è stato assegnato finora un ruolo più rilevante rispetto a quelli gassosi, anche se, in futuro, giocheranno a favore di quest''ultimi, i benefit ambientali derivanti dalla drastica riduzione di emissioni e di particolato connessi ai loro processi di combustione. Nei paesi industrializzati è prevedibile una rapida espansione del contributo delle biomasse alla copertura del fabbisogno energetico a causa della sempre maggiore attenzione che verrà data alla produzione di vettori energetici da fonti rinnovabili da impiegare nel settore dell''autotrazione. La penetrazione sul mercato dei biocarburanti dipende fortemente da diversi aspetti tra cui ritroviamo fattori puramente economici e altri tecnologici. Dal punto di vista economico il fattore chiave è senza dubbio il prezzo del petrolio, che esercita, però, il suo effetto in maniera controversa. Da una parte un suo incremento crea le condizioni per la diffusione dei biocarburanti rendendo economicamente conveniente i loro utilizzo, ma nello stesso tempo esso determina una aumento dei prezzi per la loro produzione (aumento del prezzo della materia prima) con conseguente contrazione dell''offerta. La competitività dei biocarburanti dipende inoltre anche dalla scala e dalla la messa a punto di filiere produttive innovative volte all''ottimizzazione dei consumi e delle rese di processo nonché al miglioramento del qualità del prodotto. Per l''abbattimento dei costi di produzione sarebbe auspicabile progettare filiere energetiche il cui substrato di partenza abbia ridotti o nulli costi di approvvigionamento, essendo quest''ultimo un aspetto che va ad incidere pesantemente sul costo totale di produzione. Appare del tutto evidente come la produzione di energia da rifiuti civili e agroindustriali, unitamente alla necessità di gestire adeguatamente i loro flussi, giocherà un ruolo centrale nello scenario futuro di approvvigionamento energetico da fonti rinnovabili. 4 1.2 La Digestione Anaerobica I processi di depurazione biologica sono mirati alla conversione della sostanza organica mediante meccanismi del tutto analoghi all'' auto-depurazione naturale ma con velocità di rimozione molto più elevata per l''alta concentrazione di biomassa che si sviluppa negli impianti di trattamento, grazie al controllo della loro condizioni di crescita all''interno dei bioreattori. I processi di trattamento possono essere classificati in aerobici o anaerobici in base alla presenza o all''assenza di ossigeno rispettivamente. Il trattamento aerobico, il più diffuso nelle piattaforme di trattamento, ha una maggiore versatilità nella tipologia di substrato da trattare grazie ad una maggiore varietà di microrganismi la cui attività metabolica viene svolta in parallelo (metabolismo orizzontale) utilizzando differenti composti come fonte di carbonio ed energia. Questo consente delle cinetiche di crescita della biomassa aerobica e di riduzione dei substrati maggiori rispetto ai processi anaerobici. Tuttavia il trattamento anaerobico ha dei vantaggi rispetto a quello aerobico: - Produce una minore quantità di fanghi per via delle basse cinetiche di crescita della biomassa microbica; - Consente di recuperare energia rinnovabile sotto forma di biogas; - Efficienze di abbattimento maggiori della carica patogena; - Riduce l''emissione di odori (Ward et al., 2008). Le basse cinetiche registrate in condizioni anaerobiche dipendono dal tipo di interazioni metaboliche che si instaurano tra le diverse classi di microrganismi. Come anticipato, le relazioni sintrofiche, al contrario dei trattamenti aerobici sono di tipo verticale, ossia il prodotto del metabolismo di una classe di microrganismi funge da substrato di partenza per un''ulteriore classe microbica sino alla completa riduzione di accettori elettronici tipici degli ecosistemi anaerobici (Pain and Hepherd, 1985). La degradazione anaerobica di un substrato è il risultato di una complessa serie di reazioni biochimiche che trasformano la sostanza organica fino a metano e biossido di carbonio (Figura 2). 5 Figura 2: schema semplificato della digestione anaerobica L''ecosistema anaerobico è particolarmente complesso, in quanto soltanto alcuni gruppi batterici specializzati sono in grado di effettuare determinati passaggi essenziali della biodegradazione. Il modello attualmente accettato della decomposizione anaerobica prevede diversi passaggi in cui la sostanza organica dapprima viene fermentata a CO2, H2 e acidi grassi volatili (VFA). I VFA generatesi in questo passaggio vengono convertiti ad opera di un''ulteriore popolazione di microorganismi, i cosiddetti OHPA (acetogeni produttori obbligati di idrogeno), in acido acetico, CO2 e H2, i quali rappresentano i substrati diretti per la metanogenesi. Secondo questo modello l''acido acetico è il principale precursore di metano, che viene prodotto dalla decarbossilazione appunto dell''acido acetico per il 70% (metanogenesi acetoclastica) e dalla riduzione diretta di CO 2 con H2 per il 30% (metanogenesi idrogenofila). Il complesso delle reazioni di degradazione anaerobica rappresentano un classico esempio di disproporzione in quanto i substrati organici coinvolti contengono carbonio a diversi stati di ossidazione che viene trasformato in molecole mono carboniose ossidate e ridotte. I microrganismi anaerobici sono convenzionalmente raccolti in gruppi funzionali corrispondenti ai passaggi della catena trofica (Stronach et al., 1986): - microrganismi idrolitici, che producono idrolasi capaci di solubilizzare il materiale particolato e di scindere le sostanze macromolecolari in monomeri e in oligomeri facilmente trasportabili all''interno delle cellule; - microrganismi acidogeni, capaci di fermentare monomeri complessi ad acidi o alcoli. - microrganismi acetogeni produttori obbligati di idrogeno (OHPA), capaci di convertire attraverso il processo di β-ossidazione gli acidi grassi volatili superiori in acido acetico, CO2 e H2. Gli acidi grassi insaturi vengono dapprima saturati e poi ossidati. 6 - microrganismi metanigeni che possiamo distinguere in due gruppi: a) acetoclasti, che producono metano e anidride carbonica partendo dall''acetato; b) idrogenotrofi, che producono metano partendo da idrogeno e anidride carbonica. Sono presenti anche altre due categorie di microrganismi: - microrganismi omoacetogeni, capaci di produrre acido acetico o altri composti a più lunga catena da CO2 e H2; - solfobatteri, capaci di ridurre lo ione solfato; in condizioni di solfato non limitante, essi, in virtù della loro versatilità metabolica (tollerano un potenziale redox maggiore rispetto ai metanigeni), possono competere con successo con i metanigeni per gli stessi substrati (idrogeno, metanolo, acido acetico). Anche se soltanto il 30% del metano è prodotto tramite metanogenesi idrogenofila, l''idrogeno svolge un importante ruolo regolatore in quanto la sua concentrazione influenza i principali percorsi metabolici: - nell''acidogenesi il flusso del carbonio si indirizza verso la formazione di acido acetico se la concentrazione di H2 si mantiene sufficientemente bassa, altrimenti si indirizza verso la formazione di acido propionico, di acido butirrico e di acidi grassi superiori; - la produzione di acidi organici volatili da parte degli omoacetogeni è possibile soltanto se la concentrazione di H2 si mantiene relativamente elevata; - molti microrganismi metanigeni acetoclasti possono essere inibiti da concentrazioni relativamente elevate di H2. Tra microorganismi produttori e consumatori di idrogeno si instaura quindi un forte rapporto interspecifico e i due gruppi crescono a stretto contatto fisico. In realtà i batteri fermentatori possono crescere anche in assenza di rimozione di H2, poiché possono dare luogo a prodotti meno ossidati dell''acido acetico, ossia acido butirrico, propionico e lattico. In associazione con gli idrogenofili, essi però hanno una velocità di crescita maggiore, con un maggiore vantaggio energetico. Un altro tipo di interazione positiva si instaura tra fermentatori anaerobi facoltativi e metanigeni. Gli anaerobi facoltativi rimuovono rapidamente le eventuali tracce di O2 presenti nel sistema, abbassando così il potenziale redox e rendendo l''ambiente favorevole alla vita dei metanigeni. I microrganismi fermentativi producono composti necessari ai metanigeni, i quali, a loro volta, oltre a favorire la rimozione dei prodotti della fermentazione, possono produrre alcuni amminoacidi utili alla crescita dei microrganismi. Particolarmente interessanti appaiono le 7 interazioni fra metanigeni e solfobatteri, per le quali, in presenza di SO4² ¬, si ha inibizione della metanogenesi negli ecosistemi naturali. Diversi fattori ambientali influenzano la digestione anaerobica, essenzialmente favorendo o inibendo parametri come la velocità di crescita specifica, la velocità di decadimento, la produzione di gas e il tasso di utilizzo del substrato. La produzione di biogas è il dato più significativo del processo; esso dipende, essenzialmente, dal tempo di permanenza (HRT) nel digestore e dalla temperatura di esercizio. E'' evidente che tempi lunghi di residenza dei substrati favoriscono il processo di metanogenesi, ma tale condizione può essere antieconomica su scala industriale sia perché riduce il tasso d'utilizzo degli impianti stessi e sia perché necessita di grossi volumi di reazione con conseguenti spese di installazione maggiori. Per quanto riguarda la temperatura di processo, la digestione anaerobica può avvenire in condizioni termiche psicrofile, mesofile e termofile. La psicrofilia (10-20°C) è raramente adottata su scala industriale, mentre la mesofilia e la termofilia sono molto più diffuse. I due regimi termici hanno i loro optimum rispettivamente a 37° e 55°C. In Tabella 2 sono riportate i valori ottimali delle temperature di crescita di microrganismi metanigeni isolati in diversi digestori anaerobici. Tabella 2: Intervalli di temperatura ottimali di alcune classi di microrganismi metanigeni (Gerardi, 2003) Intervallo Termico Genere Temperatura ottimale (°C) Mesofilo Methanobacterium 37''45 Methanobrevibacter 37''40 Methanosphaera 35''40 Methanolobus 35''40 Methanococcus 35''40 Methanosarcina 30''40 Methanocorpusculum 30''40 Methanoculleus 35''40 Methanogenium 20''40 Methanoplanus 30''40 Methanospirillum 35''40 Methanococcoides 30''35 Methanolobus 35''40 Methanohalophilus 35''45 Termofilo Methanohalobium 50-55 Methanosarcina 50-55 8 La struttura della comunità microbica nelle due condizioni termiche è differente. In generale il regime termico mesofilo dispone di una maggiore variabilità microbica di conseguenza lo rende maggiormente tollerante rispetto alla termofilia all''insorgere di squilibri operativi. Tale aspetto assieme al minor consumo energetico ne fa della mesofilia l''opzione più diffusa. Tuttavia il regime termofilo comporta diversi vantaggi: ' Velocità di crescita della biomassa microbica e costanti di idrolisi maggiori rispetto alla mesofilia. Ne consegue la possibilità di operare con tempi di residenza ridotti (minor volumi dei reattori) e a carichi più alti (Parawira et al., 2007); ' Maggiore solubilizzazione dei substrati che comporta un minor consumo energetico da parte dei sistemi di mescolamento; ' Maggiori efficienze di rimozione del COD e della carica batterica;
' Maggiori rese in termini di biogas prodotto. D''altra parte, come già accennato, la ridotta variabilità della popolazione batterica rende più critico il controllo del processo in caso di insorgenza di squilibri operativi. I costi di mantenimento della condizione termica termofila, dipendono largamente dall''efficienza di trasferimento di calore negli impianti. Considerando casi di studio Danesi è stato stimato che l''energia richiesta per la termofilia (55°C) ammonta al 10% della produzione totale, con un dispendio in energetico pari al 1-2% in più rispetto alla mesofilia (Angelidaki et al., 2003). Le diverse fasi della digestione anaerobica sono caratterizzate da modelli cinetici di reazione differenti. Le fasi di idrolisi e acidogenesi sono dominate da cinetiche di primo ordine, per cui generalmente all''aumentare del carico organico corrisponde un maggior accumulo dei prodotti di fermentazione, tra cui i VFA e ammoniaca. Al contrario, la fase di metanogenesi è caratterizzata da cinetiche più lente e di inibizione da substrato. L''accumulo di VFA è una delle conseguenze che si verifica in caso di sbilanciamento della catena trofica. Tra le ragioni di tale accumulo troviamo quelle legate a sovraccarichi, variazione della temperatura di esercizio, tempi di residenza ridotti, squilibri nell''apporto di nutrienti e/o assenza nei substrati da trattare di cofattori enzimatici essenziali per il processo di metanizzazione (Banks et al., 2012; Climenhaga and Banks, 2008; Neiva Correia et al., 2008). In assenza di un''adeguata capacità tamponante, l''accumulo di VFA può portare ad un'' ulteriore riduzione della performance del processo di biogassificazione in quanto i metanigeni operano al meglio a pH neutro (6.8 e 7.6) e vengono quindi rallentati dall''aumento di acidità (Mosey and Fernandes, 1989). La corretta gestione del processo in condizioni di stazionarietà porta ad un''armonizzazione delle velocità di reazione e l'abbassamento del pH non si 9 verifica a causa della formazione di sostanze tamponanti, quali ad esempio l''ammoniaca, generatesi dalla degradazione di sostanze proteiche, e l''anidride carbonica, che in pratica accompagna tutte le fasi del processo. Tuttavia l''eccesso di ammoniaca (>2000g/L), problema particolarmente sentito negli impianti che trattano effluenti di allevamento, può inibire le rese in termini di biogas (Angelidaki and Ahring, 1994). Un ulteriore e fondamentale aspetto per garantire un corretta gestione del processo di digestione anaerobica è la disposizione di un sistema di mescolamento all''interno dei bioreattori adeguato al tipo di substrato da trattare. Il tipo di mescolamento deve garantire: il massimo contatto tra la biomassa microbica e il substrato specie in presenza di materiale sospeso; disperdere rapidamente in modo uniforme l''alimentazione in tutto il volume di reazione disponibile ed evitare la sedimentazione di materiale inerte all''interno del reattore; mantenere costante la temperatura; minimizzare gli effetti inibitori dovuti a locali accumuli dei prodotti del processo degradativo. Ad una corretta miscelazione dei substrati contribuisce anche la diffusione del biogas prodotto all''interno del volume di reazione. Infine anche la presenza di nutrienti specifici risulta essere un importante elemento per la corretta realizzazione del processo. Oltre ai classici C, N, P, molti microrganismi anaerobi richiedono fattori di crescita essenziali in quanto incapaci di produrli autonomamente. La scelta del tipo e della quantità di nutrienti da aggiungere è complicata dalle seguenti considerazioni: innanzitutto una aggiunta eccessiva può innescare fenomeni di inibizioni da substrato; inoltre alcune richieste nutrizionali sono interdipendenti, come ad esempio K e Na che possono talvolta sostituirsi reciprocamente; infine, alcuni nutrienti possono non essere necessari alla crescita batterica, ma indispensabili alla stabilità del processo. Recenti studi hanno dimostrato che elementi come il Se e il Co presenti solo in bassissime concentrazioni nel food waste, fungono da cofattori essenziali per il processo di biogassificazione e per tanto devono essere addizionati in proporzioni specifiche nel feedstock di partenza (Banks et al., 2012) Le tecnologie di digestione anaerobica possono essere suddivise in tre gruppi principali in base al contenuto di solidi nel reattore (Mata-Alvarez, 2000): ' ''wet'': il contenuto di sostanza secca è inferiore al 10%; è questa la tecnica più diffusa, in particolare nel trattamento anaerobico dei liquami zootecnici. ' ''semi dry'': il contenuto di sostanza secca è intorno al 15%;
' ''dry'': il contenuto di sostanza secca è superiore al 20%. Questo tipo di processo è applicato principalmente per il trattamento dei rifiuti solidi urbani indifferenziati e/o rifiuti vegetali con un alto contenuto di cellulosa, i quali non avendo delle grosse rese in termini di biogas, 10 vengono impiegati essenzialmente come materiale strutturante, ove la fase di digestione anaerobica è seguita da una fase di compostaggio (Kristensen et al ., 2011) Dal punto di vista impiantistico la configurazione reattoristica più diffusa è di tipo CSTR (continuous stirred-tank reactor) in cui il mescolamento continuo garantisce una completa e omogenea distribuzione delle componenti in tutto il volume di reazione. Tale configurazione è più adatta per processi a basso contenuto di solidi (Reith et al., 2003). Nel caso invece del PFR (plug flow reactor) il mescolamento dei substrati avviene lungo l''asse del reattore, in assenza di interazioni con elementi precedentemente inseriti nella vasca di reazione. Questo sistema che lavora in continuo è particolarmente adatto per processi semi dry (Figura 3) Figura 3: Configurazioni reattoristiche: CSTR (sinistra) e PFR (destra) Per i processi ad alto contenuto di solidi (dry) la tipologia di funzionamento prediletta è quella discontinua (batch) in cui le biomasse palabili senza addizione di liquidi vengono poste in contenitori chiusi, riscaldati e provvisti di raccolta del biogas. Il riempimento della cella avviene con un carico unico, e lasciato maturare fino a quando la produzione di biogas diventa nulla. Il processo di digestione anaerobica può essere svolto in un unico reattore (one stage) o in più reattori, generalmente due, disposti in serie ( multi stage). L''idea di separare le fasi di processo deriva dal fatto che i microrganismi idrolitici/fermentativi e quelli acetogeni/metanigeni non condividono le stesse condizioni ambientali di crescita (Liu et al., 2006). Per tanto è possibile ottimizzare le condizioni di crescita in due reattori separatamente consentendo quindi una maggiore stabilità del processo soprattutto quando ci troviamo di fronte substrati ad elevata biodegradabilità, come ad esempio la FORSU ( Bouallagui et al., 2005; Mata-Alvarez, 2000). Di conseguenza un sistema multi stage consente di gestire meglio le fluttuazioni sia dal punto di vista qualitativo che quantitativo del carico organico e l''eventuale presenza di sostanze inibenti. I sistemi multi stage, in 11 particolare quelli a doppia fase, verranno approfonditi nei capitoli successivi nel contesto delle ottimizzazioni di processo. Diversi autori hanno dimostrato che la configurazione a doppia fase consente delle rese specifiche in termini di metano prodotto dal 6 al 21% più alte rispetto ai sistemi a singola fase con delle rimozione di solidi volatili maggiori del 9% (Nielsen et al.2004; Liu et al. 2006) . Tuttavia i sistemi multi stage hanno delle spese di investimento e di gestione maggiori rispetto ai sistemi tradizionali. 12 1.3 Substrati tipici della digestione anaerobica
Tra le fonti di biomassa comunemente impiegate nei processi di digestione anaerobica ritroviamo: - Fanghi di supero degli impianti di depurazione - La frazione organica dei rifiuti solidi urbani (FORSU) - Reflui Zootecnici - Scarti dell''agroindustria - Colture dedicate ad elevato contenuto di umidità . I fanghi da depurazione possono essere definiti come delle sospensioni acquose contenenti solidi di diversa natura generati nei processi depurativi delle acque reflue. Essi possono essere classificati in fanghi primari, se derivanti da processi di sedimentazione primaria, o secondari se generati nei processi di ossidazione biologica. A livello europeo, la progressiva implementazione della direttiva 91/271/CEE concernente il trattamento delle acque reflue urbane e la necessità di migliorare la qualità delle acque reflue depurate per un loro più ampio riutilizzo, hanno fatto aumentare il numero e l''efficienza degli impianti di depurazione, comportando un costante aumento dei quantitativi dei fanghi generati, passando da una produzione annuale di circa 5.5 milioni di tonnellate (sostanza secca) del 1995 a una produzione di circa 10 milioni di tonnellate nel 2006 (Kelessidis and Stasinakis, 2012). Le modalità più frequenti di smaltimento e riutilizzo dei fanghi depurazione vedono: il ricorso allo smaltimento in discarica; il riutilizzo in agricoltura tal quali o previo compostaggio; incenerimento o co-incenerimento con altri rifiuti. In Italia, la cui produzione annuale al 2006 risultava essere di circa 1 milione di tonnellate di sostanza secca. Lo smaltimento in discarica restava la strategia più diffusa per la gestione dei fanghi di depurazione. Attualmente le normative più restrittive in materia smaltimento in discarica, costringono a considerare con sempre maggiore attenzione l''impiego di nuove tecnologie depurative che consentono di ridurre la produzione di fanghi. Tra queste il trattamento anaerobico prima dello smaltimento in discarica o compostaggio risulta essere una buona strategia di gestione in quanto consente sia un recupero energetico che una riduzione dei quantitativi. La produzione specifica di biogas associata ai fanghi di depurazione dipende dalla loro natura: il trattamento anaerobico dei fanghi primari (fanghi generati prima delle vasche di ossidazione biologica) consente delle rese energetiche più interessanti confrontato con quello dei fanghi secondari ( derivanti dai comparti di sedimentazione secondaria) trattandosi quest''ultimi di flussi maggiormente stabilizzati dal punto di vista biologico. 13 I rifiuti solidi urbani (RSU) sono una matrice molto eterogenea di cui solo una piccola parte viene riciclata all''interno della quale possono essere identificate le seguenti classi merceologiche: - Frazione di materiale riciclabile (plastica, carta, alluminio, vetro, materiali ferrosi etc') - Frazione non riciclabile ad alto contenuto energetico adatta a sistemi termici di trattamento. - Una porzione biodegradabile ( FOP: frazione organica putrescibile) caratterizzata da alti tenori di umidità adatta a sistemi di trattamento biologici (compostaggio e digestione anaerobica) - Una porzione di materiale inerte che generalmente viene inviato direttamente in discarica. Nel 2010 in nei 27 paesi dell''Unione Europea (UE27) sono stati prodotti circa 252 milioni di tonnellate di rifiuti urbani con una lieve diminuzione rispetto agli anni precedenti. Ovviamente il dato pro-capite varia notevolmente in relazione alle condizioni socio economiche della zona di riferimento, passando da una media di 542 kg per abitante per anno nei vecchi paesi (UE15) a 342 kg/abitante anno nei nuovi stati membri (ISPRA 2012). Tra vari metodi di smaltimento degli RSU l''invio a discarica risulta essere l''opzione più gettonata nei paesi dell''UE27, con una quota pari al 38% della produzione totale di rifiuti, mentre le frazioni inviate ad incenerimento, riciclaggio e compostaggio risultano essere rispettivamente del 22, 25 a 15%. (ISPRA 2012). In Italia la produzione di rifiuti solidi urbani si è attestata nel 2010 intorno 32.5 milioni di tonnellate. Anche sul piano nazionale la produzione di RSU risulta avere una coerenza con gli indicatori socio- economici generando una diversificazione tra le diverse macroaree della penisola (Sud-Centro- Nord). Il tasso di raccolta differenziata ha raggiunto il 35.3% del totale di rifiuti urbani prodotti con una ancora più profonda diversificazione se si tengono conto i dati provenienti a livello delle diverse macroaree. Il Nord, infatti, si colloca, nel 2010, ad una percentuale pari al 49,1%, mentre il Centro ed il Sud si attestano a tassi pari, rispettivamente, al 27,1% e 21,2%. Anche a livello nazionale lo smaltimento in discarica resta la forma di gestione più diffusa interessando il 46% dei rifiuti urbani prodotti; nell''insieme le altre tipologie di recupero, trattamento e smaltimento riguardano oltre la metà dei rifiuti prodotti (54%). In particolare solo il 12% è avviato a processi di trattamento biologico, di cui solo il 2% viene trattato mediante la tecnologia della digestione anaerobica. Il consolidamento dell''attuazione delle politiche e delle normative comunitarie volte alla riduzione dei rifiuti destinati alla discarica, ed in particolare dei rifiuti biodegradabili (Direttiva 2006/12 EC), ha cambiato notevolmente la composizione dei flussi destinati ai vari sistemi di trattamento. Tale politica ha permesso di raggiungere dei tassi molto elevati di raccolta differenziata che, nel caso della provincia di Treviso, la più virtuosa secondo i dati più recenti, ha fatto registrare tassi medi sempre superiori al 70% (ISPRA 2012). Relativamente ai dati per singola classe merceologica a livello nazionale la produzione di frazione organica biodegradabile (umido + verde) 14 si attesta a poco più di 4 milioni di tonnellate con un trend di crescita di circa il 11% su base annua. Considerando la sola frazione umida proveniente da raccolta differenziata è stato stimato un potenziale nazionale di biogas pari a circa 198 milioni Nm 3 anno -1 su un totale potenziale di 1330 milioni di Nm 3 anno-1 producibile includendo la frazione di rifiuto indifferenziato (Alfano e Gaeta, 2010). Tale potenziale risulta enormemente alto se lo si rapporta al numero di impianti che trattano questo tipologia di substrato. Infatti secondo un''indagine condotta dal CRPA in cui è stata svolta un''attività di monitoraggio degli impianti digestione anaerobica su tutto il territorio nazionale, a marzo 2010 risultavano operativi 14 impianti di digestione anaerobica della FORSU, di cui alcuni operanti in regime di co-digestione con fanghi di depurazione (Piccinini et al.,2011). Reflui zootecnici. Così come per i rifiuti urbani anche l''industria zootecnica ed agroindustriale esercitano sul territorio nazionale una pressione abbastanza rilevante a causa dell''elevata quantità di reflui generati annualmente, che, se non gestiti in maniera ottimale, rappresentano un costante rischio di inquinamento. Per prevenire le emissioni di gas serra ed il rilascio di nutrienti (specialmente azoto) nell''ambiente è necessario chiudere il ciclo, dalla produzione all''utilizzo, secondo una logica di riciclo (Holm-Nielsen et al, 2009). In questo contesto è necessario sottolineare come il settore zootecnico sia considerato oggi responsabile per il 18% delle emissioni di CO2 e per il 37% di quelle di metano (23 volte il potenziale di riscaldamento globale della CO2), per il 65% delle emissioni di ossido di azoto e per il 64% delle emissioni di ammoniaca (Steinfeld et al., 2006). La digestione anaerobica di reflui zootecnici ha come scopo la conversione di queste matrici in due categorie di prodotti: da un lato il biogas, fonte energetica rinnovabile, e dall''altro il digestato, un flusso bio-stabilizzato ricco in nutrienti organici e minerali che può essere utilizzato come fertilizzante. Considerando le due principali categorie zootecniche, ossia bovino e suinicolo, sul territorio nazionale risultano essere dislocati circa 180 mila allevamenti aziendali per lo più nelle regioni settentrionali, escludendo gli allevamenti allo stato brado e semibrado, a cui corrisponde una produzione potenziale annua di circa 109 milioni di m 3 tra deiezioni solide e liquide. A tale dato è stato associato un potenziale di 1830 milioni di m 3 di biogas all''anno (Colonna e Alfano, 2010). Occorre sottolineare che le proprietà dei rifiuti provenienti dal settore zootecnico dipendono da diversi fattori: tipologia animale; tipologia di dieta (digeribilità e contenuto di proteine e fibre); età dell''animale; luogo di allevamento (condizioni ambientali). Altri fattori da considerare in termini di degradabilità del refluo sono la quantità e la tipologia delle lettiere ed il processo di degradazione durante lo stoccaggio. Tutto ciò incide poi sulle caratteristiche del refluo e, da ultimo, sul biogas ottenibile (Tabella 3). 15 Tabella 3: Caratteristiche e potenziale in biogas dei liquami considerati Come si può osservare siamo in presenza di substrati tipicamente caratterizzati da media biodegradabilità (resa in biogas di circa 0,3 m 3 biogas/kgVS) e che in alcuni casi presentano tenori in materiale azotato anche superiori al 20% (sulla frazione volatile, VS). Ne consegue che questi substrati, oltre a dar incrementi solo limitatamente significativi in termini di biogas prodotto, possono a volte limitare l''uso del digestato a causa degli elevati tenori di azoto ammoniacale. Dai dati riportati appare evidente il potenziale esprimibile in termini di energia rinnovabile prodotta, ma appare altresì evidente che il biogas ottenibile risulta tutto sommato confinato in un intervallo non particolarmente significativo. Per tale motivo risulta molto frequente osservare l''utilizzo di altri substrati in miscela con i reflui zootecnici (co-digestione) al fine di incrementare le produzioni di biogas complessivamente ottenibili. Energy crops. L''idea di coltivare piante al fin specifico di produrre biomassa per usi energetici si fonda sul dato che da piantagioni attentamente pianificate è possibile ottenere quantità di carbonio fissato e delle rese molto superiori a quelle derivanti dai soli effluenti zootecnici. Non vi è alcun dubbio del ruolo centrale che questa tipologia di coltivazioni avrà in futuro nel produrre una quantità significativa di energia, ma emerge, tuttavia , il problema della scarsità delle risorse idriche, nonché il possibile aumento dei prezzi dei prodotti alimentari a causa della conseguente minor disponibilità di superficie di terreni destinati alla produzione di prodotti agricoli. Di non minore importanza è anche il conseguente determinarsi di un certo grado di compromissione dell''equilibrio naturale derivante dall''inevitabile perdita di biodiversità. (Hanegraaf et al., 1998). In generale le colture energetiche possono essere raggruppate in 3 categorie: ' colture zuccherine: mais, cereali autunno vernini, sorgo; ' colture oleaginose: girasole, colza, soia; ' colture ligno-cellulosiche: erbacee annuali (sorgo da fibra, kenaf, canapa), erbacee poliennali (canna comune, miscanto, panico, falaride, cardo) ed arboree (pioppo, salice, robinia ecc.). 16 La categoria più comunemente impiegata nei processi di biogassificazione è quella delle colture zuccherine con una componente lignocellulosica ridotta. Il vantaggi del loro impiego derivano dal giusto compromesso che questa categoria offre tra i punti di vista gestionale e dei rendimenti. Le rese specifiche in termini di superfice coltivata dipendono da fattori climatici, tempo di raccolto e la frequenza, mentre le rese in termini di biogas dipendono essenzialmente dalla tipologia di substrato quindi dal contenuto di carboidrati, proteine, grassi e fibre. In genere le rese migliori si ottengono con il mais e gli scarti di barbabietole. Nella Tabella 4 si riportano le rese di diversi tipi di colture energetiche impiegate nella digestione anaerobica (Weiland., 2010). Tabella 4: Rese e produzione di biogas da colture specifiche La modalità di conservazione di questi materiali dopo il raccolto può influenzare anche notevolmente il processo di digestione anaerobica. L''insilamento è un processo biochimico che prevede la conversione dei carboidrati solubili in acido lattico, acido acetico, acido propionico e acido butirrico, che causano un abbassamento del pH tra 3 e 4 con inibizione di crescita di microrganismi. Una conservazione corretta del substrato è indispensabile e complementare all''attività dei microrganismi. L''insilamento viene definito come uno step di pretrattamento che degrada parzialmente i polisaccaridi strutturali e rende più efficace la conversione a biogas. Il contenuto ideale di solidi totali deve essere tra il 25% ed il 35%. Oltre alle rese sono da considerare anche i rapporti C/N che devono essere tali da evitare una eccessiva produzione di ammoniaca che porterebbe ad inibizione del processo. Tipicamente i valori di C/N devono essere tra 15 e 30. 17 2. Strategie per l''ottimizzazione dei processi di digestione anaerobica 2.1 Idrogeno e Idrometano

L''idrogeno molecolare (H 2) a livello industriale trova una serie di applicazioni che lo vedono impiegato come reagente chimico per la produzione di fertilizzanti, per la raffinazione del diesel e per la sintesi di ammoniaca (Guo et al., 2010). Guardando al settore degli autotrasporti, l'' H2 è da tempo indicato come una soluzione interessante sia per ragioni ambienali che energetiche (Tabella 5). Tabella 5: Caratteristiche dell''idrogeno molecolare come carburante (Midilli et al., 2005) Dal punto di vista ambientale rispetto ai tradizionali carburanti l''idrogeno comporta dei vantaggi in quanto dalla sua combustione non vi è alcun rilascio di gas ad effetto serra nell''atmosfera. Se si guarda al contenuto di energia per unità di massa (MJ/kg) l''H 2 ha un potenziale superiore di circa 3 volte rispetto ai tradizionali carburanti, quali ad esempio benzina e gas naturale. Ancora più superiore risulta il potenziale energetico se lo si paragona con il biodiesel. Al contrario considerando la densità energetica espressa in unità di volume (MJ/m3) l''H2 risulta essere il carburante più sfavorito. Questo aspetto ostacola enormemente l''espansione nel settore dei trasporti in quanto richiederebbe dei sistemi di stoccaggio caratterizzati da elevate volumetrie o, se si vuole ridurle, elevate pressioni; inoltre l''elevata volatilità e gli elevati range di infiammabilità in aria 18 comporta problemi di sicurezza. Altri aspetti che limitano l''impiego dell'' H 2 puro come vettore energetico solo legati all''assenza di sistemi produttivi massivi economicamente sostenibili e alla mancanza sul territorio nazionale di una rete di distribuzione adeguata; infine a causa dalla sua azione di ''embrittlement'' (infragilimento) nei confronti di alcuni materiali, necessiterebbe di componenti e tecnologie di trasporto completamente differenti rispetto a quelli dei tradizionali combustibili presenti sul mercato, compreso il metano. Ad oggi un uso concreto ed immediato dell''idrogeno come additivo alla combustione di altri carburanti. Rispetto ad altri carburanti la miscela di idrogeno e metano risulta essere la più semplice da realizzare in quanto entrambe le sostanze hanno natura gassosa e possono essere facilmente premiscelate. L''utilizzo delle miscele idrogeno-metano nel settore dell''autotrazione è incentivata dalla comunità europea (EC 79/2009) soprattutto grazie ai vantaggi ambientali che ne derivano dal loro impiego. Infatti studi effettuati sui motori a combustione interna hanno evidenziano che la miscelazione dell''idrogeno al gas naturale comporta non solo una maggiore efficienza dei propulsore ma soprattutto anche una diminuzione delle emissioni di inquinanti in misura maggiore di quanto sia riconducibile alla parte di carburante fossile sostituita dall''idrogeno. Ciò grazie al fatto che la presenza di idrogeno permette un aumento della velocità di propagazione del fronte di fiamma all''interno della camera di combustione e, di conseguenza, consente il completamento delle reazioni di combustione della miscela. Un ulteriore vantaggio dell''utilizzo della miscela idrogeno- metano sta nel fatto che essa richiederebbe sistemi per la distribuzione e lo stoccaggio on-board simili a quelli per il metano e non comporterebbe modifiche sostanziali ai tradizionali motori endotermici, permettendo così l'' utilizzo delle flotte veicolari esistenti, fatto salvo ovviamente la compatibilità dei materiali verso l''idrogeno (Martinez-Pérez et al., 2007; Klell et al., 2012). Gli effetti dell''addizione dell''idrogeno al metano dipendono dai motori impiegati per il processo di combustione e in misura nettamente maggiore dalla percentuale di idrogeno, che ne va a definire la nomenclatura della miscela . Da qui possiamo distinguere: - HCNG: miscela idrogeno/gas naturale tra il 4 e il 9% in termini di energia. - Idrometano: miscela idrogeno/gas naturale tra il 5 e il 30% di idrogeno in termini di volume. - Hythane®, marchio registrato, brevettato dalla Brehon Energy, con il quale si identifica una miscela idrogeno/gas naturale caratterizzata da un rapporto 1/5 tra l''idrogeno e metano. L''applicazione nei motori a combustione interna di tali miscele getta quindi le basi per un concreto utilizzo dell''idrogeno nel settore della mobilità (Klell et al., 2012), che costituisce una importante frazione dei consumi energetici del nostro paese e delle emissioni di CO2 sia a livello locale che a 19 livello globale. Allo stato attuale sia sul piano nazionale che su quello internazionale sono stati condotti diversi progetti volti allo sviluppo tecnologico di sistemi che consentano una piena diffusione della miscela idrogeno-metano nel settore dell''autotrazione. I loro sviluppi appracciano la produzione, lo stoccaggio e la distribuzione delle miscele H2-CH4. Qui di seguito vengono annoverati i progetti più importanti su scala globale: ' METISOL, Centro ricerche FIAT (www.h2it.org).
' BONG- HY-ENEA Casaccia di Roma (http://www.bplab.bs.unicatt.it/).
' ECOS SRL ''POR Regione Campania (Azienda Ecos- Maddaloni).
' Idrometano-Lombardia (www.regione.lombardia.it).
' ATM-ATR Emilia Romagna.
' Prius ad Idrogeno, E-Gas Rovigo.
' AVTA, Dipartimento dell''energia statunitense(http://www.eere.energy.gov/).
' ALL-HY TUDE PROJECT, Gaz de France (http://www.althytude.info/).
' Heavy '' Duty HCNG Transit Cuses Canada (www.hydrogenhighway.ca).
' CH2IP '' CANADA (http://www.powertechlabs.com/home/).
' Cina-Pechino, Brehon Energy plc (www.hythane.com).
' Naturalhy '' UE. NV Gasunie (www.naturalhy.net).
' Svezia-Malmoe (http://www.greenercities.eu/). Attualmente, la maggior parte dell''H 2 ( puro e/o miscelato ad altri carburanti) viene prodotto a partire da processi energy intensive (Es. elettrolisi dell''acqua) e/o da processi che prevedono l''uso di matrici di origine fossile (Es. steam reforming del gas naturale) nei quali, tra l''altro, sono impiegati costosi catalizzatori per operare la scissione dell''alcano. Quindi uno dei fattori che limita maggiormente la diffusione in larga scala dell''idrogeno come transportation fuel nel settore dell''autotrazione è l''elevata richiesta di energia primaria dei tradionali processi di produzione (Levin et al., 2004; Ewan et al., 2005). 20 2.2 La dark fermentation e il bio-hythane
Una notevole riduzione della richiesta di energia primaria per la produzione di idrogeno può essere ottenuta se si sfruttano i sistemi biologici. Il prodotto combustibile ottenuto mediante tali processi, meglio definito come bioidrogeno, può essere impiegato come vettore energetico all''interno dei motori a combustione interna e/o nelle Fuel Cell per la produzione di energia elettrica. Tra i vari metodi di produzione del bioidrogeno (Es. fotobiolisi biolisi diretta e indiretta; fotofermentazione ecc..), vi è la Dark Fermentation che ad oggi rappresenta la via più interessante dal punto di vista delle rese ottenibili. Essa sfrutta la capacità di alcuni microrganismi fermentativi (anaerobi stretti o facoltativi) di trasformare gli idrati del carbonio in molecole più semplici ( a peso molecolare ulteriormente ridotto), tra cui ritroviamo appunto l''H2. I vantaggi della dark fermentation rispetto agli altri processi processi biologici (Es. Fotobilogici) sono legati essenzialemte alla: - capacità di sfruttare come substrato di partenza flussi di scarto ad elevata biodegradabilità, come ad esempio la frazione organica di rifiuti solidi urbani (FORSU); - possibilità di operare in continuo; - costo di investimento prevedibilmente più contenuto se lo si rapporta alle rese del processo; Come accennato in precedenza tra i prodotti della fermentazione anaerobica ritroviamo l''H 2, che insieme alla CO2 , oltre ad essere il substrato di partenza per la produzione di metano da parte dei microrganismi idrogenotrofi, svolge anche un importante ruolo di regolatore del processo. Le complesse reazioni biologiche che portano alla generazione di idrogeno molecolare via dark fermentation sono mediate da complessi enzimatici appartenenti alla famiglia delle idrogenasi la cui classificazione dipende dal tipo di cofattore presente sul loro sito attivo. Si distinguono cosi le Fe- Idrogenasi, le NiFe-Idrogenasi e le NiSeFe-Idrogenasi. Sebbene caratterizzati da meccanismi differenti, tali complessi enzimatici catalizzano reversibilmente la riduzione dei protoni mediante elettroni forniti dall''enzima ferrodossina ridotta, la quale viene ridotta principalmente nella reazione di conversione del piruvato ad acetil''coA. Un ulteriore agente riducente della ferrodossina è rappresentato dal NADH (Nicotinammide Adenina Dinucleotide), ottenuto durante la conversione della gliceraldeide3fosfato a 1,3difosfoglicerato. La riduzione della ferrodossina ad opera del NADH si verifica esclusivamente quando la pressione parziale dell''idrogeno è molto bassa, al di sotto di 60 Pa (Mathews et al. 2009; Kraemer et al, 2007; Valdez '' Vazquez et al., 2009). Lo schema generale della Dark Fermentation (Figura 4) prevede diversi patwhay metabolici associati a diverse rese in termini di idrogeno molecolare. 21 Figura 4: Vie metaboliche nella dark fermentation (Antonopoulou et al., 2008).
Le massime rese di idrogeno (4 moli di H2 per mole di glucosio, corrispondenti a 498 ml di H2 per grammo di glucosio alla temperatura di 0° e pressione di 1 atm) sono state associate alla presenza di acido acetico come unico prodotto della fermetazione [Reazione 1] (Angenet et al., 2004; Levin et al., 2004). C6H12O6 + 2H2O ' 2CH3COOH + 2CO2 + 4H [1] Tuttavia non necessariamente un incremento di acido acetico come prodotto finale della fermentazione è indice di un miglioramento nella resa di produzione dell''idrogeno molecolare; infatti alcune specie di Clostridium (Es. Clostridium aceticum) sono in grado di convertire l''idrogeno molecolare e la CO 2 ad acido acetico [Reazione 2] (Hawkes et al., 2007); inoltre l''acido acetico insieme all''acido propionico possono derivare anche dalla fermentazione dell''acido lattico [Reazione 3] (Antonopoulou et al., 2008). 4H2 + 2CO2 '' CH3COOH + 2H2O [2] 3CH3CHOHCOOH '' 2CH3CH2COOH + CH3COOH + CO2 + H2 [3] Rispetto alla Reazione 1 le rese risultano essere dimezzate quando si considera il pathway metabolico che porta alla formazione di acido butirrico [Reazione 4], in cui vengono prodotte 2 mol di H2 per mole di glucosio, corrispondenti a 249 ml di H2 per grammo di glucosio (0°, 1atm) (Hawkes et al., 2007, Angenet et al., 2004; Levin et al., 2004). C6H12O6 ' CH3CH2CH2COOH + 2CO2 + 2H2 [4] 22 Dal punto di vista biochimico il NADH può essere ossidato generando prodotti caratterizzati da uno stato di riduzione maggiore rispetto all''acido acetico (Valdez '' Vazquez et al., 2009). La conseguente minore disponibilità di elettroni per la riduzione di protoni necessari alla formazione di H2 porta quindi ad una riduzione delle rese di processo. Un ulteriore esempio associato a basse rese di H2 è rappresentato dal Clostridium propionicum il quale consuma H2 per produrre acido propionico [Reazione 5] (Levin et al., 2004; Hawkes et al., 2007). C6H12O6 + 2H2 '' 2CH3CH2COOH + 2H2O [5] Altri prodotti della fermentazione al buio dei carboidrati sono l''etanolo [Reazione 6] e l''acido lattico, ai quali sono associate delle rese nulle di idrogeno (Antonopoulou et al., 2008). Il lattato può essere generato mediante le seguenti vie metaboliche: omofermentativa [Reazione 7], eterofermentativa [Reazione 8] e il bifidum pathway [Reazione 9]. C6H12O6 '' 2CH3CH2OH + CO2 [6] C6H12O6 '' 2CH3CHOHCOOH [7] C6H12O6 '' CH3CHOHCOOH + CH3CH2OH + CO [8] 2C6H12O6 '' 2CH3CHOHCOOH + 3CH3COOH [9] Sperimentalmente è stato evidenziato come le più alte rese di produzione di idrogeno sono state associate alla presenza di acido butirrico (Bu) e di acido acetico (Ac) tra i prodotti finali della fermentaione con rapporto tra le loro concentrazioni di circa 1.5 . Altri studi riportano un rapporto Ac/Bu = 1÷2 nelle massime fasi di produzione di idrogeno (Zhu et al. 2008, Antonopolou et al. 2008, Liu et al. 2006, Lee et al. 2010). Al contrario basse rese sono state associate a prodotti finali più ridotti, quali ad esempio alcoli e acido lattico (Hawkes et al., 2007; Levin et al., 2004; Mathews et al., 2009). Dal punto di vista dei parametri di processo la produzione di idrogeno dipende fortemente da alcuni fattori tra cui il pH, la temperatura di esercizio, il tipo di inoculo (pure colture o mixed colture), il carico organico, il tempo di residenza idraulico, il tipo di substrato nonché la configurazione reattoristica. L''influenza della temperatira si esercita principalemte sul tipo di fauna microbica che si sviluppa all''interno dei reattori e sulle cinetiche di reazione. A causa della complessità dei substrati in gioco e della variabilità delle condizioni operative, non è stata identificata una temperature ottimale di esercizio. Numerosi casi di studio riportano esperienze in cui vengono adottate colture miste mesofile (Li et al., 2007). D''altra parte la termofilia è da preferirsi quando i 23 substrati di partenza sono caratterizzati da un elevato contenuto di lignocellulosa agevolandone la fase di idrolisi. Il regime termofilo senz''altro rappresenta una condizione più difficile da gestire a causa soprattutto di una minore diversità della fauna microbica rispetto al regime mesofilo e quindi meno tollerante ad eventuali fluttuazioni delle condizioni di esercizio, ma, nello stesso tempo, consente delle maggiori rese sia di H2 che di abbattimento della carica microbica patogena, parametro importante al fine dell''utilizzo agronomico del digestato. La maggiore attività specifica delle idrogenasi è stata individuata a 55°C con un accumulo nel buffer di reazione di acido acetico, mentre il pathway che porta alla formazione di acido propionico è favorito a 20°C (Karlsson et al., 2008). Altri studi sugli effetti della temperatura di fermentazione hanno evidenziato che nel trattamento di letame bovino a 60°C e 75°C è possibile ottenere delle rese di 29.25 e 18.5 mL H2 per grammo di solido volatile (VS). In tali studi al variare della temperatura di esercizio si assiste ad uno shift della composizione microbica: a 60°C predominano i Bacteroides xylanolyticus, Clostridium stercorarium e Clostridium thermocellum, mentre a 75° C prevalgono ceppi associati al genere Caldanaerobacter subterraneus (Yokoiama et al., 2007). Come già anticipato, alte rese di processo sono state registrate in termofilia o in estrema termofilia. Da segnalare il caso del C.saccharolyticus a cui è stata associata una resa di 3.8 moli H2 per mole di glucosio (Ivanova et al., 2007). Nel caso del T.thermosaccharolyticum isolato a 60°C la massima resa registrata è stata di 2.53 mol H2 mole di glucosio (O-Thong et al., 2008). Studi condotti sempre in termofilia (Thermotoga elfii, C. Saccharolyticus, C. Thermocellum, C. thermolacticum, C. thermobutyricum e C. thermosaccharolyticum) hanno evidenziato rese comprese tra 1.5 e 3.3 mol di H2 per mole di glucosio (De Vrije et al., 2007; Niel et al., 2002; Levin et al., 2006; Collet et al., 2004; Wiegel et al., 1989; Vancanneyt et al. 1990). L''applicazione di colture pure (pure colture) per la produzione in continuo di idrogeno necessita di costosi pretrattamenti quali ad esempio heat-shock treatment (efficace solo nella prima fase di trattamento) e/o l''utilizzo di inibitori di crescita dei microrganismi idrogenotrofi (Es. BES, cloroformio, fluoroacetato e acetilene) accoppiati a raffinati sistemi di controllo per evitare l''istaurarsi di metabolismi competivi a quelli associati alla produzione di H 2 (Kraemer et al., 2007). Tali necessità rendono l''impiego delle pure colture per la dark fermentation un''opzione impraticabile dal punto di vista economico se si pensa ad una loro applicazine su scala industriale. Per tanto l''attenzione dei ricercatori si è spostata principalemte sulle colture miste (mixed culture) che consentono, data la varietà dei consorzi microbici coinvolti, un numero maggiore di gradi di libertà in riferimento alle condizioni di esercizio se si dovessero verificare fenomeni di sbilanciamento della catena trofica anaerobica. In uno studio effettuato da Wang et al., (2009) è 24 stato dimostrato che è possibile selezionare comunità microbiche produttrici di idrogeno a partire da substrati organici non sterili, senza ricorrere dunque a lunghe fasi di acclimatazione degli inoculi. Per quanto riguarda il carico organico in letteratura non è riportato un valore ottimale in quanto esso dipende da diversi fattori concomitanti. In generale è possibile affermare che gli alti carichi (maggiori di quelli applicati nei comuni digestori anaerobici) sfavoriscono la crescita dei metanigeni per via della loro cinetica di crescita che viene inibita ad alte concentrazioni substrato. Al contrario i microrganismi fermentativi sono dotati di una cinetica di crescita di primo ordine (Kraemer et al., 2007), quindi all''aumentare del carico organico aumenta la concentrazone di prodotto. E'' sovente comunque trovare in letteratura una condizioni di carico al di sotto o al di sopra delle quali le rese e la cinetica di produzione di idrogeno diminuiscono (Shin et al., 2005). Il pH è un altro fattore molto importante che va ad incidere sulle rese del prcesso. In genere variazioni del pH modificano la composizione microbica con conseguente variazione dello spettro di metaboliti finali (Ye et al., 2007; Ginkel et al. 2001; Temudo et al. 2007). Il range ottimale per la produzione di H2 varia da 5-6. All''interno di tali valori i complessi enzimatici delle idrogenasi esercitano la massima attività ad una temperatura di 55°C (Kim et al., 2004; Kim et al., 2006; Doi et al., 2009). Riuscire a mantenere il pH in tale range per lunghi periodi di esercizio risulta essere però un problema in assenza di controllo esterno, in quanto gli alti carichi comportano un accumulo di sostanze di natura acida (VFA) generando cosi un suo abbassamento. Valori di pH inferiori al 5 favoriscono lo sviluppo di metabolismi associati a bassi livelli di H2. Risulta per tanto molto frequente in letteratura trovare casi di studio in cui vengono applicati controlli esterni del pH (aggiunta di NaOH e/o HCl). Aspetto che però incide aumentando i costi di gestione della dark fermentation su scala industriale. Passando al tempo di residenza idraulico, l''adozione di bassi HRT (nell''ordine di qualche giorno) favorisce lo sviluppo di microrganismi fermentativi rispetto a quelli metanigeni a causa delle più basse velocità di crescita di quest''ultimi. Nella maggior parte dei casi in letteratura si riporta un range che va dalle 8 ore ad un massimo di 3÷5 giorni in base al carico organico, al tipo di substrato e alle condizioni di temperatura applicate. Per quanto riguarda la scelta reattoristiva vi sono casi in cui l'' HRT coincide con SRT e altri dove i due parametri risultano indipendenti. Nel primo caso il CSTR, largamente impiegato, ha il grande vantaggio di essere facilmente gestibile e controllabile proprio perché le condizioni all''interno del reattore sono, in linea teorica, omogenee in ogni suo punto. Nel secondo caso le configurazioni reattoristiche più utilizzate sono l'' UASB (Upflow anaerobic sludge blanket reactor) e l''ASBR (anaerobic sequencing batch reactor). La preferenza di alcuni autori per questo tipo di reattori più 25 complessi da studiare e da gestire deriva dalla convinzione che aumentando l''età del fango si possano raggiungere rese superiori (Hallenbeck et al., 2009; Reith et al., 2003). La pressione parziale dell''idrogeno nel reattore può risultare un fattore inibente il processo di produzione di H2 esercitando il suo effetto sulle ferrodosine, che come già detto, fungono da agenti riducenti delle idrogenasi. Per rimediare a ciò si può ricorrere all''insufflaggio di gas inerte all''interno dei reattori per allontanare l''idrgeno e/o all''impiego di membrane selettive di varia natura (Kim el., 2006; Nath et al., 2004). Dall''analisi critica della letteratura risulta che vi sono diversi limiti di processo, legati essenzialmente all''instaurarsi di fenomeni di instabilità quando si applicano periodi sperimentali di lunga durata. La produzione di H2 via Dark Fermentation per via dei bassi tempi di residenza idraulici applicati, richiede una gestione più accurata rispetto al classico processo di digestione anaerobica finalizzato alla produzione di biogas. Spingere alla massima efficienza un processo che è solo la parte iniziale di una catena trofica, mantenere le condizioni ottimali per la produzione di H2 per lunghi periodi di esercizio, evitando quindi l''instaurarsi di metabolismi competitivi, è l''obiettivo primario della ricerca in questo settore. Infatti il sistema da solo non è in grado di autoregolarsi e necessita quindi di costosi interventi di controllo che implicano un aumento dei costi di gestione che limitano la penetrazione sul mercato del bioidrogeno. Nel contesto delle ottimizzazioni del processo di digestione anaerobica una configurazione che si è andata via via affermando negli anni è quella che prevede la separazione delle fasi tipiche della catena trofica anaerobica mediante la disposizione in serie di più bioreattori in modo tale da ottimizzare separatamente le condizioni ambientali di crescita dei differenti microrganismi che compongono l''ecosistama anaerobico. L''idea nasce appunto dal fatto le diverse classi di microrganismi non condividono le stesse condizioni ambientali ottimali di crescita, in quanto questi differiscono ampiamente in termini fisiologici, di cinetiche di crescita, di richieste nutrizionali e di sensibilità alle condizioni a contorno. Nei sistemi multi stage la configurazione più diffusa è quella a doppio stadio in cui nella prima fase vengono fatte svolgere le reazioni di idrolisi/ acidogenesi (dark fermentation) mentre nella seconda fase, alimentata con l''effluente del primo reattore, prendono piede le reazioni di acetogenesi/metanogenesi. La tecnologia della doppia fase è stata sviluppata sin dagli anni 70 (Pohland et al., 1971) con l''idea che con sistemi del genere è possibile ottenere delle rese di processo migliori in termini di biogas prodotto e di degradazione della sostanza organica. Il processo viene visto quindi come la somma di due macro-reazioni, quella iniziale della Dark Fermentation e quella finale più impropriamente definita di Metanogenesi. Sviluppi recenti sui sistemi a doppia fase hanno visto il focalizzarsi dell''attenzione dei ricercatori non solo sull''ottimizzazione del processo di solubilizzazione del particolato organico al fine di 26 aumentare le rese, ma anche e soprattutto sul miglioramento della qualità del biogas prodotto mediante arricchimento in idrogeno del gas finale prodotto (Figura 5) ( Ueno et al., 2007). Il biogas così ottenuto prende il nome di Bio-hythane (5-15% H2; 50-60% CH4; 2-30% CO2) e in modo del tutto analogo all''idrometano comporta vantaggi sia dal punto di vista ambientale che di prestazioni del motori a cui la miscela viene applicata. Figura 5:Configurazione a doppia fase per la produzione di bio-hythane La produzione del Bio-hythane da FORSU , non ha ancora trovato ancora piena applicabilità su scala industriale. Tuttavia in letteratura esistono diversi esempi su scala di laboratorio e pilota di applicazioni di digestione anaerobica a doppio stadio, mirati alla produzione combinata di idrogeno e metano. Prendendo in considerazione i casi di trattamento di rifiuti organici, dall''analisi critica della letteratura è emerso che l''eterogeneità dei dati è più accentuata per quelli relativi alla fase di Dark Fermentation rispetto al processo di digestione anaerobica. Questo aspetto è da giustificarsi essenzialmente per i bassi tempi di residenza applicati nella fase fermentativa, in genere da 0.5 a 5d, che portano a maggiori fluttuazioni dei parametri di processo. Riferendoci al parametro HRT è stato riscontrato che le velocità di produzione di idrogeno (HPR) aumentano al diminuire dei tempi di residenza applicati (Figura 6), e che un aumento di temperatura consente di spingersi verso tempi di residenza minori. 27 Figura 6:Andamento della velocità di produzione di idrogeno in funzione dell''HRT L''applicazione di bassi HRT in sistemi CSTR consente il wash out dei metanigeni (Hawkes et al., 2007; Kyazze et al., 2007), e di conseguenza favorisce lo sviluppo dei microrganismi fermentativi produttori di idrogeno. In ogni caso l''HRT deve essere maggiore del tasso di crescita specifico dei microrganismi produttori di idrogeno per evitare il loro wash out (Hawkes et al., 2007; Hallenbeck and Ghosh., 2009). Vi è da sottolineare inoltre che essendo la produzione di idrogeno influenzata da tanti altri parametri, nel voler scegliere un valore ottimale di HRT questo necessariamente non coinciderà con i valori più bassi. Questo è evidente quando il trattamento prevede l''impiego di substrati complessi (maggior contenuto lignocellulosico) ove un aumento dei tempi di residenza può favorire la solubilizzazione del particolato organico (Valdez''Vazquez et al., 2009). Sperimentazioni mirate all''ottimizzazione della fase fermentativa hanno spesso previsto un controllo del pH (Shin et al., 2005; Gomez et al., 2006; Ueno et al., 2007a,b; Lee et al., 2010; Kim et al.2008a,b) e/o pretrattamento dell''inoculo e/o del substrato (Han et al. 2005; Kim et al., 2008a,b; Chou et al., 2008; Lee et al., 2010). Una pratica interessante che si è andata sviluppando negli ultimi anni in alternativa all''impiego di chemicals esterni per il controllo del pH nella fase di Dark Fermentation è quello di applicare un ricircolo in testa al processo proveniente dalla fase di metanogenesi al fine di sfruttare la capacità tamponante residua (Es. Sali ammoniacali, bicarbonato) di questa matrice (Cecchi et al 2005). L''applicazione di tale ricircolo consente di bilanciare l''apporto di nutrienti e di diluire il feedstock di partenza (Kataoka et al., 2005; Chu et al., 2008; Lee et al., 2010). Un altro aspetto vantaggioso di questa soluzione è che è possibile aumentare il tempo di residenza dei fanghi idrogenotrofi all''interno della fase fermentativa. Tuttavia a lungo termine il continuo ricircolo può portare ad un aumento di alcalinità nel sistema favorendo la proliferazione di microrganismi idrogenotrofi e abbassare le rese del processo in termini di produzione di H2. Il problema principale che può manifestarsi nel caso in cui si scelga il sistema a due fasi con ricircolo, riguarda l''accumulo di ammoniaca. Studi mostrano come, operando in condizioni termofile , 28 l''ammoniaca libera sia responsabile dell''inibizione della produzione di metano a concentrazioni al di sopra di 700 mg/l (Angelidaki et al., 1994). Altri studi condotti da Salerno et al. (2006) hanno evidenziato come non solo il tasso di produzione del metano ma anche quello di bioidrogeno può essere inibito dalla presenza di ammoniaca. Per ovviare al problema di accumulo di ammoniaca Lee et al. (2010) a valle della fase di metanogenesi hanno previsto l''installazione di una vasca di nitrificazione per la riduzione dell''ammoniaca. Partendo da un feedstock caratterizzato dal 10% di TS sono state raggiunte le rese di 83LH2/kgVS ad un carico organico applicato di circa 28kgTVS/m 3 rd. Kobayashi et al. (2012) ha evidenziato che l''apporto di ione ammonio è necessario a l''attività microbica dei microrganismi fermentativi idrogeno produttori e che è possibile aumentare le rese in H2 mediante un trattamento termico del fango ricircolato finalizzato all''inibizione degli microrganismi idrogenotrofi. Nonostante la moltitudine studi condotti in mesofilia, è stato ormai assodato dalla comunità scientifica che il regime termico ottimale per la produzione di idrogeno nei sistemi a doppia fase è quello termofilo con delle rese specifiche di idrogeno che arrivano fino a 205H2/kgTVSfeed (Chu et al., 2008) La grande variabilità delle rese di processo riscontrate dipende ovviamente dalla moltitudine di condizione operative applicate e dalla scelta della configurazione reattoristica. Per la convenienza pratica ed economica che comportano, i sistemi CSTR sono quelli più diffusi per la Dark Fermentation, in modo particolare in applicazioni che prevedono l''impiego di colture miste (Hawkes et al., 2007). Non mancano però i casi in letteratura dove si adoperano sistemi batch, particolarmente adatti se si vogliono studiare le migliori condizioni operative relative alla biomassa attiva in esame, o sistemi progettati per aumentare il tempo di ritenzione della biomassa all''interno dei reattori (UASB, AFR, FBR) con lo scopo di migliorare le efficienze di conversione e di minimizzare le volumetrie di installazione (Kotsopoulos et al., 2006; O-Thong et al., 2008; Wu et al., 2008; Zhang et al., 2008) . Tuttavia l''insorgere di fenomeni di accumulo è una problematica in cui spesso questo tipo di sistemi possono andare in contro (Kim et al., 2005; Gavala et al., 2006) e necessitano quindi di particolari accorgimenti tecnologici (Kim et al., 2006; Kumar and Das., 2001; Lee et al., 2006; Lo et al., 2009; Zhang et al., 2008). Nella moltitudine di condizioni operative applicate non è stato possibile stabilire una condizione di carico organico ottimale per i sistemi a doppia fase. I range sono molto alti e vanno da i 4kgTVS/m 3 rd ai 70kgTVS/m 3 rd. Se si considerano però i casi di studio a doppia fase con ricircolo tale range si restringe notevolmente e va da circa 9 a 38 kgTVS/m 3 rd. Wang et al., (2009) afferma che le rese di produzione di H2 e CH4 diminuisco all''aumentare del carico organico con dei valori massimi di produzione intorno a 0.09 m 3H 2/kgTVS e 0.55m 3CH 4/kgTVS ad un carico organico 29 applicato di 15kgTVS/m 3 rd e 3kgTVS/m 3 rd rispettivamente per i reattori della Dark Fermentation e di metanogenesi. Per quanto riguarda la fase di metanogenesi c''è molta più omogeneità nei dati. La configurazione più adottata è il CSTR. Al contrario da una minor diffusione sono caratterizzati le configurazioni dove l''SRT è maggiore dell''HRT; tra quest''ultimi l''UASB offre dei vantaggi per trattamento di composti organici solubili ad elevata biodegradabilità a causa dell''elevata superfice specifica che offrono i fanghi granulari, inoltre presenta minori problemi di gestione rispetto alle altre configurazioni (Parawira et al. 2006). I valori della velocità di produzione riscontrate (GPR) variano da 1,6 m 3CH 4/m 3d a 4 m3CH 4/m 3d, con un massimo di 6,1 m 3CH 4/m 3d (Ueno Y. et al. 2007). Le produzioni specifiche (SGP) vanno da i 300 a 550L di CH4 per kgVS (Liu et al., 2006, Wang et al., 2009). I carichi variano tra i 4 kgVS/m 3d e gli 8 kgVS/m3d, con un massimo di 15,7 kgCOD/m3d in termofilia (Ueno et al. 2007). Gli HRT invece dimostrano una disomogeneità sorprendente, trovando casi che vanno da circa 2 d sino ai 30 d, con una maggioranza comunque tra i 5 d e i 15 d. I problemi riscontrati nella fase di metanogenesi sono legati: all''accumulo di ammoniaca quando si adopera un ricircolo; accumulo di VFA con conseguente abbassamento del pH a causa degli elevati carichi applicati nella prima fase (Lee et al. 2010) , specie se si ha a che fare con substrati ad elevata biodegradabilità, richiedendo cosi la necessità di intervenire dall''esterno mediante l''aggiunta di sostanze tamponanti (Forbes et al., 2010; Venetsaneas et al., 2009). Altri autori accusano nel lungo termine la mancanza nei substrati di partenza di microelementi essenziali per l''attività degradativa dei microrganismi, in particolar modo cofattori enzimatici necessari per la degradazione dell''acido propionico (Banks et al., 2012). 30 2.3 Pre-trattamenti meccanici della frazione organica dei rifiuti solidi urbani
Dai primi anni novanta la Comunità Europea ha intrapreso una politica in materia di rifiuti culminante con la direttiva del 2008 (EU Waste Framework Directive 2008/98/EC) in cui viene definita la necessità di differenziare i rifiuti solidi urbani per favorire il recupero e riciclaggio. Ha inizio così la generazione di una tipologia di flusso di rifiuti organici avente delle caratteristiche che risultano non essere più idonee a trattamenti come l''incenerimento o l''invio diretto a compostaggio, a causa dell''elevato contenuto di acqua . Con la suddetta Direttiva, il Parlamento Europeo obbliga gli stati membri ad adottare le migliori tecnologie disponibili nell''ambito della gestione dei rifiuti in relazione alle loro condizioni specifiche territoriali . Negli ultimi anni la tecnologia della Digestione Anaerobica di matrici organiche è risultata un''opzione molto gettonata per via del recupero energetico che è possibile effettuare prima dello smaltimento in discarica o compostaggio (De Baere and Mattheeuws., 2010; Cecchi et al., 1990) . Se si considera le potenzialità del parco digestori disponibile a servizio delle linee fanghi degli impianti di depurazione (circa 36000 nell''Unione Europea), l''implementazione del processo di co- digestione con la porzione biodegradabile dei rifiuti porterebbe ad un recupero di 112.000 MWh di energia elettrica e 180.000 MWh di energia termica, rispondendo così alla sempre più diffusa richiesta di recupero energetico da risorse rinnovabili. Il rendimento in biogas e quindi energetico del processo di co-digestione anaerobica è molto variabile e dipende principalmente dalla qualità del rifiuto organico conferito. Nonostante le alte efficienze di raccolta differenziata raggiunte negli anni grazie alle politiche comunitarie, la FORSU , sia ottenuta da raccolta alla fonte che da raccolta differenziata, contiene una porzione di frazione di materiale non idoneo al processo di trattamento ( circa il 30% nei contesti territoriali più virtuosi), quali plastiche, materiale lignocellulosico, inerti etc. Pertanto essa necessita di essere pretrattata al fine di aumentare da una parte la frazione biodegradabile da inviare alla successiva fase di trattamento biologico, e dall''altra incrementare la quota di materiale ad alto potere calorifero da inviare ad incenerimento (CDR: combustibile derivato dai rifiuti). Quindi uno dei fattori che limita la realizzazione di impianti di digestione anaerobica dei rifiuti civili è che il processo richiede appunto installazioni meccaniche costose per la separazione dei flussi con costi in fase di investimento tali da rendere economicamente vantaggiose altre opzioni di trattamento (Hartmann et al., 2004). Per questo motivo la strategia di raccolta del rifiuto deve essere considerata come parte integrante del processo di trattamento, permettendo di ottenere una tipologia di substrato più o meno adatto al processo biologico. 31 Le tipologie di pretrattamento della FORSU negli impianti di digestione anaerobica, essendo questi progettati e realizzati in tempi in cui le efficienze di raccolta differenziata non avevano raggiunto i livelli odierni e dovendo trattare quindi flussi con un livello di contaminanti maggiore, vedono spesso sistemi ad alta potenza specifica installata con approcci ''distruttivi'' i quali portano inevitabilmente ad una maggiore dispersione della componente inerte causando una maggiore abrasione delle pompe nonché riduzione del volume di reazione all''interno dei digestori. (Ritzkowsky et al. 2006; Velis et al. 2010). Ne consegue maggior numero di interventi di manutenzione e incremento dei costi di gestione. La scelta della tecnologia di pretrattamento dipende dal tipo di flusso in entrata e in ottica di ottimizzazione di processo deve essere bilanciata sulla quantità di energia recuperata al netto della potenza installata e sulla qualità dell''effluente generato da inviare alla successiva sezione di stabilizzazione biologica. In generale ogni sistema di pretrattamento della FORSU ha lo scopo di: ' Allontanare la porzione di materiale non idoneo , con conseguente aumento della quota biodegradabile da inviare alla successiva fase di digestione(Tchobanoglous et al. 1993). ' Ridurre la pezzatura del materiale digeribile al fine di aumentare la superfice specifica colonizzabile dai microrganismi (Müller et al. 1998; Palmosky and Müller 2000) ' Omogenizzare e regolare il contenuto di solidi nel feedstock di partenza (Mata Alvarez et al. 2000) Tutte le tecnologie di pretrattamento sono caratterizzate da operazioni unitarie comuni che sfruttano diverse proprietà al fine di effettuare la separazione del materiale indesiderato, quali: proprietà dimensionali, proprietà gravimetriche e proprietà magnetiche. In linea generale la filiera di selezione dedicata a FORSU consiste nella: ' Dilacerazione per mezzo di trituratori primari e macchine rompi sacchi a rotazione lenta. In tale operazione viene effettuata l''apertura dei contenitori di raccolta dei rifiuti e la prima riduzione di pezzatura del materiale più voluminoso in modo da favorire la successiva selezione del materiale. L''operazione viene effettuata mediante apparecchiature rompisacchi, che permettono una frantumazione non spinta del rifiuto, che altrimenti potrebbe compromettere i successivi trattamenti a causa della presenza di materiali fini inerti triturati e mescolati alla rimanente parte del rifiuto. Recentemente, proprio a causa del fatto di dover lavorare con substrati sempre più selezionati, le apparecchiature di norma utilizzate sono i mulini ad alberi lenti e rulli contrapposti, che sostituiscono l''utilizzo di macchine tipo 32 i mulini a martelli, che generano una commistione troppo spinta tra le varie frazioni costituenti il rifiuto. I trituratori ad alberi contrapposti sono dotati di sistemi automatici anti- inceppamento ad inversione del senso di rotazione degli assi nel caso dovessero essere presenti materiali inerti di grosse dimensioni che potrebbero danneggiare l''apparecchiatura. La scelta della tipologia di trituratore più idoneo avviene solitamente sulla base della portata oraria del rifiuto da trattare (parametro che influenza direttamente anche i consumi elettrici) e pezzatura finale del prodotto da ottenere. Oltre a queste caratteristiche sono da considerare i prezzi di acquisto ed i costi di gestione specie in termini di consumo elettrico. ' Deferrizzazione per l''allontanamento di materiali ad alta e a bassa densità magnetica. La separazione dei metalli si ottiene impiegando separatori magnetici per metalli ferrosi e separatori a correnti indotte per metalli non ferrosi. Esistono due tipologie: a nastro e tamburo. Dal punto di vista applicativo la scelta del tipo di separatore dipende dalla tipologia di rifiuto, quindi dal tipo di raccolta effettuata a monte, e dalla pezzatura del flusso da trattare. In generale i sistemi a tamburo sono economicamente vantaggiosi. ' Separazione di inerti e plastiche. Essa viene comunemente definita ''vagliatura'' e si basa sulle differenti dimensioni che caratterizzano i materiali contenuti nel rifiuto trattato. Il flusso entrante in un separatore dimensionale, viene suddiviso in due flussi distinti chiamati: sottovaglio (o sovvallo) cioè il materiale raccolto nelle tramogge sottostanti il separatore; sopravaglio cioè la parte di materiale che rimane sopra le ''maglie'' di separazione e giunge dall''estremità della macchina. I vagli separano i materiali per pezzatura, attraverso il passaggio attraverso uno o più corpi dotati di fori appositi (si hanno quindi vagli mono- o pluri-stadio). Le apparecchiature di vagliatura più diffuse sono i vagli a tamburo (i più diffusi grazie alla loro versatilità), i vibrovagli (più adatti per selezionare rifiuto da raccolta indifferenziata) ed i vagli a dischi ( impiegati in particolare nei settori di trattamento dei prodotti cartacei e plastici provenienti dalla raccolta differenziata e nel trattamento del rifiuto solido misto). La separazione oltre che basata sulla dimensione può sfruttare le proprietà gravimetriche del materiale. I principali sistemi impiegati per la separazione gravimetrica sono: classificatori ad aria; classificatori a letto fluido e separatori balistici. ' Controllo della pezzatura. Di norma è necessario sottoporre il flusso di rifiuti organici diretti al reparto di preparazione del substrato ad una riduzione delle dimensioni, allo scopo di rendere la pezzatura compatibile con il processo e con le apparecchiature utilizzate per la movimentazione della miscela. Nella fase di controllo della pezzatura si genera normalmente un unico flusso con caratteristiche dimensionali il più omogenee possibile. La granulometria dei substrati da inviare al processo di co-digestione anaerobica influisce 33 direttamente sulle rese, in quanto la degradazione del substrato organico dipende dalla superficie di contatto tra quest''ultimo ed i microrganismi. Una pezzatura adeguata deriva da un compromesso tra costi di gestione e manutenzione ed efficienza. Per questa operazione unitaria sono particolarmente indicati i mulini a coltelli con un funzionamento simile a quello visto per i rompisacchi ma con spessori di taglio nettamente inferiori (dell''ordine dei millimetri). ' Omogeneizzazione e regolazione del contenuto di umidità. Tale operazione è necessaria sia al fine di garantire il corretto funzionamento del processo e di ottimizzare le rese di metanizzazione, sia per poter movimentare con maggiore facilità il materiale, specialmente nei processi a secco (> 20%) o semi-secco (circa 15% TS). I rifiuti devono essere diluiti in modo da regolare l''umidità della miscela al valore ottimale, prima dell''invio all''unità di digestione. L''obiettivo può essere raggiunto tramite l''aggiunta di fanghi provenienti dalla depurazione delle acque oppure con acqua di servizio. Oltre alla regolazione del contenuto di acqua è anche necessario provvedere all''omogeneizzazione della miscela prima dell''introduzione nel digestore. I tipi di miscelatori maggiormente utilizzati sono: miscelatori a coclee per processi a secco o semi-secco e idropolpatori per processi ad umido o semi-secco. I dispositivi di agitazione o miscelazione devono essere realizzati in materiale resistente all''azione abrasiva o corrosiva dei materiali costituenti i rifiuti. L''unità di miscelazione deve essere facilmente accessibile ed ispezionabile, al fine di consentire lo svolgimento delle operazioni di pulizia e di manutenzione ordinaria e straordinaria. Aldilà delle tecnologie comuni, alla chiusura della filiera di trattamento spesso sono previste tecnologie specifiche scelte sulla base delle caratteristiche del flusso e dalle quali dipendono essenzialmente i costi di investimento/manutenzione e la potenza specifica installata. Tra le tecnologie commercialmente più diffuse troviamo: idropolpatori , presse d''estrusione, presse a vite , sistemi di selezione a dischi rotanti e sistemi di selezione ad umido . Tutte queste tecnologie, eccetto l''idropolpatore, sono caratterizzate da basse potenze specifiche installate. La tecnologia del pulper (Figura 7) prevede il contemporaneo '' spappolamento'' ad umido della frazione organica all''interno di un contenitore agitato con fanghi di supero (o acqua di processo) e rimozione del materiale indesiderato. Si tratta di una tecnologia a vasta diffusione sul mercato in quanto consente di trattare matrici con un diverso grado di purezza. L''alta potenza installata consente lo sfibramento del materiale digeribile grazie a forze di taglio idrauliche sino a formare una sospensione con pezzatura inferiore ai 10 mm. I materiali indesiderati si separano dalla miscela, formando una sospensione della frazione leggera e una frazione pesante che sedimenta. Sul fondo 34 del pulper è presente uno scarico, mentre la frazione leggera che galleggia è allontanata tramite un rastrello. La parte centrale della miscela nel pulper è costituita da una sospensione organica omogenea, pompabile, con un tenore di solidi intorno al 10%, che viene estratta e inviata alle fasi successive. La velocità del pulper è regolata nella fase di trattamento in modo da garantire sia la sedimentazione dei materiali grossolani che lo sfibramento della parte organica. Generalmente a monte del pulper sono previsti solo sistemi rompi sacchi e di rimozione del materiale grossolano. A valle del pulper la sospensione organica, previo passaggio in un vaglio conico, è inviata a un sistema per l''eliminazione degli inerti fini ancora presenti. Si tratta di una particolare stazione di ciclonatura che permette di eliminare le sabbie che altrimenti provocherebbero usure eccessive e intasamenti nei macchinari a valle della sezione di pre-trattamento. I principali vantaggi di tale sistema sono rappresentati dall''ampio campo d'applicazione, un''alta flessibilità rispetto alla variazione (quantitativa) della composizione dei rifiuti, la possibilità di adattare la fase di processo a variazioni del materiale immesso. I limiti sono rappresentati dai consumi energetici che non sono trascurabili, dalla necessità di avere una miscelazione a valle del sistema e anche dalla quantità di scarto che si ottiene dall''intero processo, che generalmente non può essere avviata a recupero, ma deve essere smaltita. Figura 7: Idropolpatori per il trattamento della FORSU La tecnologia della presso estrusione (Figura 8) si basa sulla separazione fisica di due frazioni ( secca e umida) e non su quella dimensionale. E'' un sistema adatto particolarmente per flussi ad alto grado di purezza. Sottoponendo il rifiuto ad alta pressione in una camera di estrusione forata si ottiene la fluidificazione delle parti propriamente organiche (residui alimentari, frazioni putrescibili varie) che spinte dalla differenza di pressione tra interno ed esterno della camera vengono separate da quelle meccanicamente più resistenti (plastiche, vetro, gomme, '). Il ciclo della presso estrusione è costituito da tre fasi distinte: la fase di alimentazione, la fase di compressione vera e propria esercitata dal cilindro principale e la fase di espulsione effettuata da un cilindro secondario 35 alloggiato in opportuna posizione. E'' solamente richiesta una macchina lacera sacchi a monte oppure la separazione dei grossi imballaggi, nel caso di conferimenti da grandi utenze. La tipologia di separazione, con la formazione di una polpa liquida in uscita, sulla base di esperienze di letteratura, sembra inoltre favorire il successivo processo di digestione, aumentando la biodegradabilità della frazione organica . La frazione organica presso estrusa si presenta infatti come una ''polpa'' che risulta essere una massa omogenea estremamente adatta alla stabilizzazione anaerobica grazie alle caratteristiche di elevata porosità ed elevata superficie di contatto disponibile per lo sviluppo delle popolazioni microbiche. I consumi specifici sono molto ridotti e si aggirano intorno ai 11-13kWh/ton di rifiuto trattato (De Poli, 2008) Figura 8:Presso estrusore La tecnologia della screw press (Figura 9) consiste in una camera metallica dotata di un cestello forato con luce circa 10 mm. A seguito della separazione si ottengono due flussi: una porzione ad alto contenuto di frazione organica biodegradabile (20-25% TS) che, eventualmente può essere inviata direttamente a compostaggio; e una ad alto contenuto di frazione non biodegradabile. La pressione d''esercizio determina la distribuzione delle due porzioni nei due distinti flussi. Tale pressa al vantaggio di avere delle basse potenze specifiche installate e per tanto adatta a flussi ad alto grado di purezza. Al di là della bassa versatilità di rifiuto trattabile un altro limite è dato dal fatto che nel flusso da inviare in discarica o incenerimento è presente ancora una grossa porzione di materiale biodegradabile. Figura 9: Screw Press 36 La tecnologia del disc screen (Figura 10) consente la separazione dei flussi sulla base della loro densità. L''unità consiste di un letto verticale di dischi posti ad una determinata distanza tra di loro in modo tale da permettere la caduta del materiale pesante di piccole dimensioni, mentre il materiale leggero di maggiori dimensioni (essenzialemte materiale organico) raggiunge un contenitore di carico dal quale viene trasferito alla successiva sezione di stabilizzazione biologica. Il sistema è adatto a flussi ad alto grado di purezza ed è caratterizzato da bassi consumi energetici. Figura 10:Disc Screen La wet selection (Figura 11) è una tecnologia di pretrattamento a basso consumo energetico caratterizzata da una serie di operazioni unitarie che la rendono particolarmente adatta a flussi con un alto grado di purezza. Il processo deve essere considerato nella sua interezza e si compone delle seguenti parti: - triturazione primaria - deferrizzazione - vagliatura - separazione metalli non ferrosi - triturazione secondaria - miscelazione con fanghi nel mixer Dalla fossa di ricevimento la FORSU passa ad un trituratore monoasse primario che ha anche la funzione di rompisacchi. Il flusso di rifiuto mediate una coclea viene trasferito ad un vaglio a tamburo. La deferrizzazione è operata da un separatore a magneti permanenti. Il materiale triturato e privo di materiali ferrosi ad alta densità magnetica viene inviato in un vaglio rotante a tamburo per la separazione del materiale organico (sottovaglio) dagli inerti di grosse dimensioni quali plastiche, carte e cartone. Tramite una coclea il materiale è trasferito ad un secondo deferizzatore. 37 Quest''ultimo è costituito da un sistema a nastro con magneti speciali in grado di generare la presa sia di materiali ferro-magnetici e di materiali con bassa permeabilità magnetica. Il nastro ha anche funzione di caricamento del trituratore secondario. Nel trituratore secondario il materiale subisce un''ulteriore riduzione di pezzatura, in una camera a rulli controrotanti con lame circolari. Sempre a mezzo di coclee il materiale è inviato ai mixers in cui viene miscelato con i fanghi di supero ispessiti, fino ad un contenuto in secco intorno al 5%. La sezione dei mixers ha la funzione di ottenere al contempo una miscela omogenea con i fanghi e di operare un''ulteriore pulizia del rifiuto organico triturato. Si sfrutta la diversa densità del rifiuto triturato e dei materiali indesiderati, ovvero inerti ad alta densità che tendono ad accumularsi sul fondo dei reattori e da qui possono essere estratti, e i materiali flottanti quali plastiche che restano nella parte alta e vengono allontanati a mezzo di appositi raschiatori superficiali. Il materiale allontanato viene lavato in appositi macchinari e scaricato in cassoni per essere avviato a smaltimento, mentre l''effluente è inviato ad una screw-press per un''ulteriore separazione della parte liquida da quella solida. La screw-press (pressa a vite) separa la fase liquida, che viene alimentata al digestore, da quella solida. Il vantaggio di tale sistema è che l''intera filiera è caratterizzata da consumi piuttosto contenuti pari a circa 20 kWh/t di materiale trattato. Figura 11:Wet Selection
Nei 14 impianti Italiani censiti dal CRPA che trattano FORSU l''idro-polpatore è il sistema più diffuso. Attualmente tale scelta non è da considerarsi adeguata in un ottica di ottimizzazione di processo per via degli alti consumi energetici non giustificati dal grado di purezza dei flussi in gioco. L''efficienza di separazione è un aspetto molto importante ai fini della gestione tecnico- economica dell''intera piattaforma di trattamento. Appare del tutto evidente che un sistema capace di intercettare una maggiore quota di materiale organico biodegradabile consente un incremento delle 38 rese in termini di biogas. Il dati merceologici inoltre vanno incrociati con quelli relativi alle qualità chimico-fisiche dei flussi in uscita dei pretrattamenti e i consumi energetici specifici. Studi condotti in piattaforme di trattamento rifiuti Danesi hanno evidenziato che le screw press portano ad alte efficienze di separazione se confrontate con la tecnologia disc screen e con sistemi che prevedono il solo impiego di trituratori e magneti (Hansen et al., 2007). D''altra parte dall''analisi granulometrica effettuata la screw press genera un flusso a pezzatura molto ridotta, in cui è presente una grossa porzione di sabbie. Questo è un aspetto molto importante se si considera che un flusso ad alto contenuto di sabbie porta ad una maggiore abrasione dei sistemi meccanici, intasamento dei tubi e riduzione del volume di reazione a causa della loro sedimentazione nei digestori. Un altro limite comune a tutte le tecnologie in esame è dato dal fatto che una grossa porzione di materiale biodegradabile è ancora presente nel flusso da inviare in discarica o incenerimento (Hansen et al., 2007; 2012; Bernstad et al., 2012). In ottica di ottimizzazione dei processi di digestione anaerobica da FORSU il sistema di pretrattamento ideale dovrebbe essere in grado di: - portare ad alte efficienze di rimozione del materiale inerte non biodegradabile - ridurre al minimo le perdite di materiale biodegradabile - ridurre in consumi energetici - di intercettare il maggior numero di sabbie al fine di ridurre i costi di gestione 39 2.4 Processi di digestione anerobica di substrati agroindustriali

Gli impianti per la digestione anaerobica di substrati provenienti da agroindustria possono essere legati a due approcci di utilizzo: il trattamento dei soli reflui provenienti dalla zootecnia, finalizzati più che altro alla stabilizzazione del materiale in quanto la conversione a biogas è bassa per questi substrati; co-digestione con substrati ad alto rendimento (energy crops e/o sottoprodotti dell''agroindustria). Nel 2008 in Italia risultavano operativi 150 impianti di DA nel settore agricoli classificabili per il tipo di substrato trattato (Tabella 6). Tabella 6: Numero impianti e tipologia di substrato trattato in Italia- (fonte CRPA 2008) Tipologia di substrato trattato Impianti (n.) Solo liquame suino 41 Solo liquame bovino 38 Liquame suino + liquame bovino 5 Liquame bovino e/o suino e/o pollina + scarti organici + colture energetiche 35 Liquame bovino e/o suino e/o pollina + colture energetiche 20 Colture energetiche e/o scarti organici 9 Pollina + scarti organici e/o colture energetiche 3 Totale 150 Da un''analisi dimensionale condotta su tutte le aziende zootecniche dislocate sul territorio nazionale è stato evidenziato che buona parte di esse non superano la soglia tecnico-economica per consentire un investimento in un impianto accoppiato ad un motore di cogenerazione elettrica (Colonna e Alfano, 2010). Laddove l''investimento è stato effettuato autonomamente, quindi impianti non consortili, al fine di sfruttare al massimo le tariffa di incentivazione governativa omnicomprensiva di 280 '/MWh prodotto, il regime di funzionamento prevalentemente adottato per gli impianti di taglia non superiore ad 1MWe è stato quello della co-digestione principalmente con colture dedicate (insilati di mais, triticale etc') e, in misura nettamente minore, con scarti dell''agroindustria. Nel suddetto scenario l''Italia ha visto negli ultimi anni (2008-2011), cosi come in Europa ( Bolzonella et al., 2011; Weiland, 2010), un drastico aumento del numero di impianti realizzati nel settore agricolo (da 150 a 521) facendo registrare una potenza installa di circa 350MWe (Figura 12). 40 Figura 12: Impianti di Digestione Anaerobia Agricoli e Potenza Installata in Italia. (CRPA, 2011) In generale il 57% degli impianti censiti nel 2011 e rapportandoli al totale di potenza installata solo il 7.3% di questi è alimentato con soli effluenti zootecnici, mentre la restante parte opera in regime di co-digestione con colture dedicate e scarti dell''agroindustria. Al fine di dare un''idea delle tecnologie presenti sul mercato per poter effettuare una valutazione dei possibili interventi di ottimizzazione di processo, qui di seguito vengono descritti alcuni esempi di processi maggiormente diffusi nel settore agricolo: Processo Bekon. La tecnologia BEKON (Figura 13) permette lo sfruttamento di biomasse accatastabili e ammassabili con contenuti di sostanza secca fino al 50% per la produzione di energia. A seguito di un inoculo di materiale già fermentato il substrato di alimentazione viene caricato in celle chiuse ermeticamente. La modalità di funzionamento è batch e senza movimentazione interna dei substrati. Il percolato dal materiale fermentato viene prelevato attraverso un canale di drenaggio, immagazzinato temporaneamente all''interno di un serbatoio e poi spruzzato nuovamente sul substrato di fermentazione per umidificarlo. Il processo di fermentazione si svolge ad una temperatura di circa 37°C, ed il controllo della temperatura avviene grazie ad un trattamento di riscaldamento del fondo e delle pareti. Il biogas che ne deriva viene utilizzato all''interno di una centrale termoelettrica monoblocco al fine di ottenere energia elettrica e termica. Affinché il biogas a disposizione della centrale termoelettrica sia sempre sufficiente, all''interno dell''impianto di fermentazione a secco vengono azionati più reattori di fermentazione, i quali sono programmati secondo precisi intervalli di tempo. Al termine del periodo di permanenza delle sostanze in una camera di fermentazione questa viene svuotata completamente ed in seguito riempita nuovamente. Il substrato fermentato viene generalmente convogliato ad una fase di compostaggio successiva, in modo tale da ottenere un convenzionale materiale comparabile al concime organico. 41 Figura 13: Tecnologia Bekon. Processo Linde. La Linde ha brevettato processi adatti ad entrambe le tipologie di digestione anaerobica: a secco e ad umido . I sistemi Linde a umido possono essere sia a fase unica sia doppia e possono lavorare sia in regime termico termofilo (preferibile) che mesofilo. Questo tipo di impianti prevedono il pre-trattamento della matrice di alimentazione per la rimozione di solidi mediante separatore a tamburo. La caratteristica del sistema Linde è il ricircolo del gas nel digestore. Il processo di digestione a secco, per materiali con tenore in secco nell''intervallo 15-45% TS, utilizza reattori con schema plug flow orizzontali con sezione trasversale rettangolare. La Figura 14 illustra schematicamente la conformazione impiantistica tanto per processi ad umido che a secco.
Figura 14. Processo Linde: wet (sinistra) e dry (destra)
Processo Schmak. Il reattore brevettato da Schmak consiste in un fermentatore orizzontale, attraversato per tutta la lunghezza da un agitatore ad aspo che con la sua rotazione lenta e continua impedisce la formazione di schiume o strati galleggianti (Figura 15). Il calore immesso è costante ed è generato dall''albero dell''agitatore. Questa particolare soluzione consente di lavorare con alte percentuali di sostanza secca nel reattore. Durante questa prima fase il digestato diviene per natura più liquido, e viene fatto passare nei due post-fermentatori, dalla più tradizionale pianta circolare, sul cui tetto in legno è posto un feltro su cui crescono dei batteri preposti alla desolforazione 42 naturale del biogas. Sulla sommità dei post-fermentatori è posto il gasometro, costituito da un telo in EPDM (ethylene propylene diene monomer) . Il biogas raccolto viene quindi deumidificato ed inviato al cogeneratore, che produce energia elettrica e calore.
Figura 15:Schema di processo Schmak
Processo BTS. La tecnologia BTS, molto diffusa in Italia , prevede una digestione di tipo wet. Gli impianti sono costituiti da un sistema a due fasi in cui si ha una prima digestione a 40°C seguita da un digestore secondario, sempre riscaldato, dove viene ultimata la digestione dei substrati più difficili da decomporre. Dopo la digestione la biomassa digerita passa in una vasca di stoccaggio non riscaldata. Le peculiarità di questa tecnologia sono: il sistema di miscelazione modulabile in altezza e con bassi consumi; un bioestrusore che permette la pesata, la triturazione e l''alimentazione temporizzata ai digestori; sistema di essiccamento bio-dry del digestato, con recupero del calore proveniente dalla cogenerazione; sistema di telecontrollo del processo. Processo UTS. La U.T.S ampiamente diffusa in Italia, utilizza la classica digestione ad umido, in fase singola o a due stadi, in cui i sistemi di pompaggio delle matrici vengono differenziati a seconda delle caratteristiche così come i sistemi di miscelazione interna. Processo LIPP. La tecnologia LIPP è sostanzialmente dedicata al trattamento di matrici ad alto contenuto in sostanza secca: lo sviluppo del reattore è ad asse orizzontale con miscelazione ottenuta da un albero centrale rotante (Figura 16). In questo caso non sono disponibili molti dati di funzionamento in letteratura per quanto riguarda il processo in sé, mentre viene sottolineata più che altro la logica costruttiva dei digestori. Questa consiste nella realizzazione di serbatoi metallici tramite un sistema a doppia piegatura, secondo il quale un nastro metallico di particolare sezione viene avvolto a spirale, formando un cilindro metallico poggiante su di una base in calcestruzzo. Il 43 reattore opera in regime mesofilo (30-35°C) con tempi di ritenzione di almeno 30 giorni ed è ideato per il trattamento di reflui bovini: il dimensionamento è eseguito sulla base di 0,9 m3 di reattore per capo di bestiame (da 500 kg p.v.). Figura 16:Processo LIPP La serie di interventi finalizzate all'' ottimizzazione del processo di digestione anaerobica nel settore agricolo prevedono l''applicazione di specifiche tecnologie per il miglioramento dell''efficienza biologica ed energetica degli impianti. L''innovazione più diffusa dal punto di vista impiantistico prevede la separazione delle fasi mediante l''installazione di un pre-reattore di idrolisi di diversa configurazione (Figura 17). Il risultato consiste in una produzione di energia superiore al 20% rispetto ai processi CSTR monofase convenzionali, per impianti di potenza superiore a 50KWe (Mezzadri, 2011). Figura 17: schema di processo a due fasi di digestione anaerobica per impianti agroindustriali Altre soluzioni riguardano l''istallazione di sistemi di mescolamento a maggiore efficienza e a basso consumo energetico. Per ridurre i consumi legati ai sistemi di agitazione spesso al mescolamento continuo si preferisce l''adozione di cicli temporizzati. Infine al fine di aumentare le rese in metano 44 alcuni processi prevedono sia l''adozione di pretrattamenti dei substrati di diversa natura (chimici, termochimici, enzimatici meccanici ecc.) che l''utilizzo di residui e scarti agricoli (sottoprodotti di lavorazione) in sostituzione (totale o parziale) di biomasse vegetali dedicate (energy crops). In relazione a quest''ultime la recente direttiva comunitaria 2009/28/EC sulle energie rinnovabili ( Annex V.A in Directive 2009/28/EC) interviene disincentivando l''impiego di energy crops come substrato di partenza per la produzione di biocarburanti essendo questo un feedstock sfavorevole dal punto di vista del Life Cicle Assessment (LCA). Tale direttiva è stata recepita recentemente in Italia nel nuovo decreto del 6 luglio 2012 sulle energie rinnovali il quale alla voce specifica biogas agricolo esclude dalla fascia di incentivazione medio-alta gli impianti di grossa taglia e alimentati con colture dedicate. Al contrario viene favorito il co-trattamento di effluenti d''allevamento con sottoprodotti dei cigli produttivi agroalimentari. Inoltre nel futuro piano di incentivazione oltre all''incentivo base sono previsti dei moltiplicatori se si impiegano tecnologie volte a: - recuperare e/o rimuovere l''alto contenuto di azoto che caratterizza gli effluenti degli impianti digestione anaerobica (in modo particolare quelli che trattano effluenti d''allevamento) e che rappresenta una sorgente di rischio per fenomeni di eutrofizzazione dei corpi acquiferi superficiali e di inquinamento delle falde sotterranee. - Produrre biometano mediante l''up-grading del biogas, con lo scopo di immetterlo direttamente nella rete del gas naturale e al suo utilizzo nel settore dei trasporti. - Favorire la cogenerazione ad alto rendimento ( vedi manuali GSE 2012). 45 3. Finalità della ricerca La produzione di energia da rifiuti solidi urbani e scarti dell''industria zootecnica e agroalimentare unitamente alla necessità di gestire in maniera adeguata i loro flussi all''interno dei contesti territoriali locali, gioca un ruolo di primaria importanza nella ricerca di fonti energetiche alternative a quelle di origine fossile. A causa dell''alto contenuto di umidità che caratterizza tali flussi l''unico metodo di trattamento che consente di chiudere in positivo il bilancio energetico è la conversione biochimica in biogas mediante la tecnologia della digestione anaerobica. Ottimizzazione del processo di produzione di bio-hythane. Nel contesto delle strategie di ottimizzazione dei processi di digestione anaeobica, una configurazione impiantistica che si è andata diffondendo negli ultimi anni è quella che prevede la separazione delle due principali fasi della catena trofica anaerobica, ossia la fermentazione (l''idrolisi e l''acidogenesi) dalla dall'' acetogenesi e metanognesi (metanogenesi), in modo tale da ottimizzare in reattori differenti le condizioni di crescita delle due principali classi di microrganismi ( fermentativi e metanigeni) che compongono il complesso ecosistema anaerobico. Mantenendo il primo reattore in opportune condizioni operative è possibile indirizzare le reazioni della prima fase della catenza trofica verso la produzione di idrogeno (Dark Fermentation). La configurazione a doppia fase prevede che l''effluente del primo reattore viene impiegato per alimentare un secondo reattore nel quale i prodotti della fermantazione vengono vengono in biogas (Figura 18). Figura 18: Schema di processo per la produzione accoppiata idrogeno (via dark fermentation) e
metano
46 In modo del tutto analogo allo schema evidenziato in Figura 18, uno degli obiettivi della presente tesi di dottorato è stato quello di sviluppare in reattori CSTR su scala pilota di grossa taglia, un processo di digestione anaerobica termofilo a doppia fase separata utilizzando come substrato di partenza la frazione organica dei rifiuti solidi urbani. Il processo di ottimizzazione era mirato allo sviluppo di un processo continuo di produzione di biogas arricchito con una quota di H2 pari al 5- 15% del volume totale del gas prodotto. La misela così ottenuta prende il nome di bio-hythane la quale a seguito del processo di combustione comporta dei vantaggi rispetto al classico biogas sia dal punto di vista ambientale che motoristico al classico biogas ( minor rilascio di gas ad effetto serra e maggiore efficienza dei motori a combustione interna rispettivamente). L''analisi critica della letteratura ha evidenziato una discordanza di opinioni in merito al carico organico ottimale per la produzione di bio-hythane. Per tanto nella prima fase di studio sono stati tre RUNs sperimentali caratterizzati da tre differenti carici organici al fine di definire quello ottimale in riferimento alle qualità e alla quantità della miscela totale di gas prodotta. Come evdenziato nella figura 18, lo schema di processo ha previsto l''applicazione del ricircolo in testa processo della frazione liquida dell''effluente del reattore di metanogenesi con l''obiettivo primario di sfruttare la sua capacità tamponante ed evitare quindi di ricorrere all''utilizzo di un buffer esterno al processo necessario a tamponare il pH intorno al valore ottimale per la produzione di idrogeno (5.5) nella fase di dark fermantation. Tale approccio consente di ridurre l''apporto di alcalinità esterna quindi ridurre i costi di gestione del processo. D''altro canto, in modo particolare per i processi termofili, la presenza di ammoniaca nel flusso di ricircolo può essere causa di fenomeni di sbilanciamento della catena trofica anaerobica per via della tossicità esercitata quando l''ammoniaca libera raggiunge determinate concentrazioni ( ~ 700mg/L). Per tanto la seconda fase di studio è stata caratterizzata da un lungo periodo sperimentale dove è stata valutata la stabilità del processo di produzione di bio-hythane a un lungo termine in cui è stata testata la possibilità di implementare un sistema di controllo automatico. Confronto tra diversi sistemi di pretrattamento della FORSU. Un secondo obiettivo della tesi è stato quello di confrontare diversi sistemi di pretrattamento meccanico della frazione organica dei rifiuti solidi urbani necessari per ridurre la quota di materiale inerte da inviare alla successiva sezione di stabilizzazione anaerobica. La necessità di tale sperimentazione deriva dal fatto che i sistemi di pretrattamento installati negli maggior parte degli impianti di digestione anaerobica della FORSU sono stati concepiti in tempi in cui la raccolta differenziata non aveva raggiunto i livelli odierni di efficienza per tanto, dovendo trattare flussi più eterogenei ad alto contenuto di materiale inerte, sono caratterizzati da tecnologie ad elevato consumo specifico. Inoltre sistemi di questo tipo sono spesso caratterizati da bassa efficienza di separazione comportando quindi un''elevata 47 dispersione di materiale inerte a valle del pretrattramento. Ciò a sua volta comporta repentini interventi di mantenzione sulle componeti meccaniche, intasatura dei sistemi di pompaggio liquido e, in assenza di adeguati sistemi di mescolamento, di riduzione del volume utile di reazione all''interno dei reattori per via dell''innescarsi di fenomeni di sedimentazione. L''attività di studio condotta ha visto quindi il confronto qualitativo dei flussi generati da 4 sistemi di pretrattamento della FORSU attualmente disponibili sul mercato. Ottimizzazione dei processi i co-digestione anaerobica nel settore zootecnico. Infine per quanto riguarda il settore zootecnico è stata condotta un'' attività di ricerca mirata all''ottimizzazione dei processi di co-digestione anaerobica di effluenti d''allevamento con matrici tipiche del settore agroinustriale. In Italia negli ultimi anni, così come in Europa, c''è stato un brusco incremento del numero di impianti finalizzati alla produzione di biogas nel settore zootecnico. Poiché il trattamento anaerobico dei soli effluenti d''allevamento non consente delle rese in termini di biogas tali da sfruttare al massimo gli incentivi previsti sulle energie di rinnovabili (280'/MW fino al 31/12/2012), la maggior parte degli impianti di digestione anaerobica che trattano effluenti d''allevamento opera in regime di co-digestione con matrici che consentono delle rese più interessanti. Si tratta essenzialemte di colture dedicate (energy crops), quali ad esempio quelle appartenenti alla famigia dei cereali ( insilato di mais, triticale, loietto etc'), che richiedono grossi consumi in termini di acqua, energia e fertilizzanti. Il piano di incentivazione previsto per i nuovi impianti, recependo le direttive europee, a partire dal 1 gennaio 2013 ( DM sulle energie rinnovabili del 6 luglio 2012) penalizza l''utilizzo di energy crops a vantaggio di sottoprodotti dell''industria agroalimentare. Per il settore zootecnico è stata condotta una sperimentazione che ha visto l''impiego in parallelo di quattro reattori (CSTR) di grossa taglia, volta alla definizione delle migliori condizioni operative in termini di temperatura, carico organico, tempo di residenza idraulico e substrato di partenza. In particolare sono stati condotti tre RUNs sperimentali caratterizzati da tre diverse miscele di partenza: effluenti d''allevamento bovino (RUN1) ; effluenti d''allevamento bovino ed insilato di mais (RUN2) ; effluenti d''allevamento bovino, insilato di mais e sottoprodotti vegetali dell''industria agroalimentare (RUN3). Poiché la maggior parte degli impianti operativi sono ubicati in area sensibile (Bacino scolante nell''area della laguna di Venezia) e per tanto gli operatori sono soggetti a procedure più restrittive (Applicazione dellaa Direttiva Nitrati) per effettuare lo spandimento in campo dei surnatanti anaerobici, la sperimentazione ha avuto lo scopo di definire le migliori condizioni operative non solo dal punto di vista delle rese di processo in termini di biogas ma anche in merito alla qualità degli effluenti generati, con riferimento particolare alla distribuzione delle forme azotate. 48 4. Materiali e metodi 4.1 Metodi per la Produzione di Bio-hythane.
4.1.1 Reattori ed inoculo
Per l''ottimizzazione del processo di produzione di bio-hythane sono stati utilizzati due reattori CSTR (Figura 19) realizzati in acciaio AISI 304 e completamente miscelati mediante agitatori meccanici ad ancora a bracci, mossi da motori elettrici da 2.2 kW installati. Gli alberi sono centrati nella parte superiore da un sistema a baderna, che ne assicura la tenuta perfetta riguardo al gas prodotto. L''alimentazione è stata effettuata in maniera manuale attraverso un boccaporto superiore. Lo scarico avveniva per troppo pieno da una guardia laterale. Il gas veniva recuperato dalla parte superiore ed inviato ad una guardia idraulica esterna, che aveva lo scopo di mantenere una pressione di esercizio interna pari a 0.1 metro di colonna d'acqua. Il riscaldamento dei due reattori è stato effettuato tramite una camicia esterna, mantenuta a temperatura da un boiler a circolazione forzata. Il controllo di temperatura, mantenuta nel range ±1°C, avveniva in due punti: il primo all''interno del boiler, al fine di non superare la temperatura massima di esercizio della caldaia, e il secondo all''interno del digestore mediante sonde PT100. I due reattori, caratterizzati dal volume utile di 200L e 760L rispettivamente per la fase di dark fermentation e di metanogenesi, sono stati disposti in serie all''interno dell''aerea sperimentale del WWTP del comune di Treviso.
Figura 19: reattori impiegati per la produzione di bio-hythane: dark fermentation (sinistra) e
metanogesi (destra) Poiché la FORSU è un substrato non sterile, per la fase di dark fermentation non è stato utilizzato alcun inoculo ma è stato fatto in modo che si sviluppasse una flora microbica endogena. Per favorire lo sviluppo di microrganismi fermentativi il reattore è stato sovraccaricato con una miscela 49 di FORSU e acqua, in rapporto di 2:3. Tale scelta deriva dalla necessità di dover creare condizioni sfavorevoli di crescita per i microrganismi metanogeni e favorire, al contrario, lo sviluppo dei microrganismi tipici della prime due fasi (idrolisi e acidogenesi: dark fermentation) della catena trofica anaerobica (Appendice 1). La fase di metanogenesi è stata inoculata direttamente con un fango anaerobico prelevato da un CSTR wet presente nell''impianto di Treviso e operante in mesofilia (~40°C) in regime di co- digestione (fanghi di supero e FORSU) con un carico organico di circa 1.5 kgTVS/m 3d e tempi di residenza nell''ordine dei 20 giorni. Subito dopo le operazioni di carico, le matrici presenti nei due reattori hanno mostrato le caratteristiche riportate nella Tabella 7. Tabella 7: caratteristiche degli inoculi (produzione di biohythane). Paramentro Unità Dark Fermentation Metanogenesi TS g/kg 95 22 TVS g/kg 87 12 TVS/TS % 91 53 pH - 4.7 7.6 VFA mgCOD/L 3452 349 N-NH4 + mg/L 745 650 Alcalinità Parziale pH6 mgCaCO3/L - 3840 Alcalinità Totale pH4 mgCaCO3/L - 5184 COD g/kg 96 15.5 TKN g/kg 2 0.4 P g/kg 0.6 0.1 L''inoculo della fase di dark fermentation era caratterizzato da una concentrazione di TS intorno al 10% del peso umido con un''alta frazione di solidi volatili (> del 90% dei TS). L''alta porzione di componente biodegradabile all''interno del reattore ha comportato l''innescarsi sin dalla fase di pre- miscelazione di fenomeni fermentativi, come indicato dalla presenza di ammoniaca (745mg/L) e di acidi grassi volatili (3.4 gCOD/L). Quest''ultimi, in assenza di capacità tamponante, hanno comportato un''acidificazione del mezzo (pH=4.7). La presenza di VFA inoltre è dovuta a l''insorgere di fenomeni pre-fermentativi già in fase di stoccaggio del rifiuto. Ciò evidenzia l''alto grado di biodegradabilità della FORSU che assieme ad una buona distribuzione dei macronutrienti (COD, TKN , e P) ne fa un substrato particolarmente adatto a processi di trattamento biologico. 50 Come già anticipato, come inoculo della fase di metanogenesi è stato impiegato l'' effluente del digestore anaerobico in esercizio. Di conseguenza la matrice era caratterizzata da un avanzato stato di stabilizzazione come indicato dalla bassa percentuale di solidi volatili sui solidi totali, 53%, e dal rapporto COD/TS (0.69). Per quanto riguarda i parametri di stabilità l''inoculo era caratterizzato da una buona capacità tamponate ( 5184mgCaCO3/L), da un basso contenuto di VFA (346mgCOD/L), da valori di pH intorno a 7.6 ed una concentrazione di azoto ammoniacale di circa 650 mg/L. 4.1.2 Substrati e alimentazione

L''alimentazione dei due reattori è stata effettuata in modalità discontinua con cadenza giornaliera per 5 giorni a settimana. La prima fase (dark fermentation) è stata alimentata con la FORSU conferita nell''impianto di Treviso. Al fine di incrementare la superfice specifica colonizzabile dai microrganismi, la FORSU dopo una fase di pretrattamento per la rimozione degli inerti , è stata sottoposta ad un ulteriore step di riduzione della pezzatura mediante un trituratore primario a coltelli seguito da un dissipatore ad umido sotto lavello. La sperimentazione relativa al processo di produzione di bio-hythane è stata caratterizzata da due fasi sperimentali (vedi Tabella 10). Nella prima fase la tecnica di raccolta differenziata adottata era esclusivamente mediante cassonetti centralizzati, mentre nella seconda fase sperimentale una quota del rifiuto conferito nell''impianto proveniva da raccolta porta a porta, quindi caratterizzata da un maggiore grado di purezza in termini di biodegradabilità . Nelle Tabella 8 e Tabella 9 sono riportate le caratterizzazioni della FORSU relative ai due periodi sperimentali a valle del pretrattamento meccanico. Tabella 8: Caratterizzazione della FORSU (prima fase sperimentale: cassonetti centralizzati) Parametro UM Media ± DS Min Max Solidi Totali (TS) gTS/kg waste 263 ± 40 175 346 Solidi Volatili (VS) gVS/kg waste 216 ± 28 157 276 TS/VS % 82 ± 4 75,3 90 P-PO4 gP/kgTS 2.5 ± 2 0.4 4.9 TKN gN/kgTS 30± 10 6,3 42,2 COD gO2/kgTS 743 ± 105 608 953 51 Tabella 9: Caratterizzazione della FORSU (seconda fase sperimentale: cassonetti centralizzati +
porta a porta) Parametro Unit Average Value Min Max Total Solid (TS) gTS/kg waste 266 ± 54 226 316 Volatile Solid (VS) gVS/kg waste 219 ± 46 189 246 VS/TS % 83 ± 3 76 85 P-PO4 gP/kgTS 4.2 ± 1 3.2 5.4 TKN gN/kgTS 31 ± 10 16 54 COD gO2/kgTS 985 ± 94 880 1153 I due periodi sperimentali sono stati caratterizzati da un substrato di partenza molto simile con un contenuto medio di solidi totali pari al 26% del peso umido totale ed una frazione di solidi volatili superiore all''80% dei TS. La maggiore differenza evidenziata riguarda il rapporto COD/TS, che nel primo periodo sperimentale , in cui la raccolta veniva effettuata mediante cassonetti centralizzati, era di 0.75. Nel secondo periodo sperimentale tale rapporto era di 0.96. Quindi il minor stato di ossidazione del rifiuto dovuto probabilmente ai minori tempi di residenza nei rispettivi contenitori di stoccaggio indica una maggiore efficacia della tipologia di raccolta del rifiuto adottata (porta a porta + cassonetti centralizzati). Infine gli alti valori delle deviazione standard in termini di percentuale rispetto ai relativi valori medi di azoto e fosforo totale suggerisce un sostanziale grado di eterogeneità della matrice in esame. Il contenuto di solidi totali nel feedstock di partenza è stato regolato nel range 5-8% mediante l''aggiunta di acqua e fase liquida dell''effluente del reattore di metanogenesi. Quest''ultimo reattore è stato alimentato con il flusso in uscita dal reattore fermentativo. 4.1.3 Condizioni operative

Lo scema di processo adottato in questa sperimentazione è quello riportato nella figura seguente: Figura 20: Schema di processo adottato adottao per la produzione di biohythane 52 Lo schema di processo prevedeva l''impiego di un ricircolo della fase liquida dell''effluente del reattore di metanogenesi. La separazione delle fasi liquida e solida è stata condotta mediante un separatore gravitazionale dotato di una coclea. Nella Tabella 10 sono riportate le condizione operative adottate nei due reattori: Tabella 10: Condizioni operative per il processo di produzione di biohythane Prima Fase Sperimentale (130giorni) Seconda Fase Sperimentale (345 giorni) RUN 1 RUN 2 RUN 3 RUN 4a RUN 4b RUN 4c Dark Fermentation HRT (giorni) 3.3 3.3 3.3 3.3 3.3 3.3 OLR (kgTVS/m 3 rd) 16 21 18 16 16 16 *Qr/QTot 0.5 0.5 0.5 0.5 0.25 Variabile T (°C) 55 55 55 55 55 55 V (m 3) 0.2 0.2 0.2 0.2 0.2 0.2 Metanogenesi HRT (giorni) 12.6 12.6 12.6 12.6 12.6 12.6 OLR (kgTVS/m 3 rd) 4.2 5.6 4.8 4.2 4.2 4.2 T (°C) 55 55 55 55 55 55 V (m 3) 0.76 0.76 0.76 0.76 0.76 0.76 * La portata di ricrcolo Qr è riferita alla sola fase liquida del digestato in uscita dalla metanogenesi.
L''attività di studio è stata articolata in due fasi sperimentali. La prima fase, volta alla definizione delle migliori condizioni operative in termini di carico organico applicato, ha avuto una durata complessiva di circa 145 giorni. All''interno di questa fase sperimentale si possono distinguere tre diversi periodi (RUN1 , RUN 2 e RUN 3) caratterizzati da tre diverse condizioni di carico organici. Con riferimento specifico al reattore della dark fermentation nel RUN 1, in cui è compresa anche la fase si start up, è stato applicato un OLR di 16kgTVS/m 3 rd. Il RUN 2 e il RUN 3 sono stato stati caratterizzati rispettivamente da un OLR rispettivamente di 21 e 18 kgTVS/m 3 rd. Il carico organico applicato nel reattore di metanogenesi è stato nella prima fase sperimentale è rientrato nel range 4- 6kTVS/m3rd. Nella seconda fase sperimentale (RUN 4), che ha avuto la durata di circa 350 giorni, si è passati alla valutazione della stabilità dell''intero processo in un periodo di lunga durata mediante l''applicazione di un''unica condizione operativa, definita sulla valutazione dei risultati ottenuti nella prima fase sperimentale; in particolare si è voluto verificare se i valori dei parametri di processo impostati (HRT, ricircolo etc.) permettevano di raggiungere e confermare uno stato stazionario stabile e duraturo e, in secondo luogo, di verificare se la modifica della quantità di ricircolo possa stabilizzare il processo all''insorgere di inibizioni dovute in primo luogo all''accumulo di ammoniaca. 53 Le condizioni operative in termini di carico organico adottato nel RUN 4 sono state le stesse del RUN 1, poiché quest''ultimo, come vedremo nel capitolo dei risultati, ha evidenziato le migliori performance in termini di quantità e qualità del gas prodotto complessivamente. Il RUN 4 a sua volta è stato caratterizzato da tre periodi in ognuno dei quali è stato applicato un differente rapporto Qr/Qt. Per il RUN 4A e RUN 4B il rapporto Qr/Qt è stato rispettivamente di 0.5 e 0.25. Poiché l''entità di tale rapporto va ad incidere sulla stabilità dell''intero processo, nell''ultima fase sperimentale esso è stato variato quotidianamente sulla base degli andamenti di alcuni parametri chiave di processo, in particolar modo ammoniaca, pH e composizione del gas. I tempi di residenza e le temperature di esercizio applicate nei due reattori sono stati mantenuti costanti per l''intera durata della sperimentazione. Nel reattore di dark fermentation l''HRT era nell''ordine dei 3 giorni al fine di consentire il wash out dei microrganismi metanigeni per via delle cinetiche di crescita più lente rispetto ai microrganismi fermentativi. Al contrario nel secondo reattore al fine di portare a termine le reazioni culminanti con la produzione di biogas sono stati applicati HRT più lunghi, di circa 13 giorni. Il regime termico adottato è stato quello termofilo per i vantaggi che esso comporta rispetto a quello mesofilo già ampiamente discussi nei capitoli precedenti. 4.1.4 Test di evaporazione

L''unità di rimozione dell''azoto a valle del separatore di fase era rappresentato da un evaporatore fornito da Veolia Water S&T Italia S.r.l (modello R150v3). Si tratta di un evaporatore sotto vuoto a pompa di calore e sistema raschiante con scambiatore di calore a camicia riscaldante. L''apparecchiatura sfrutta l''effetto combinato del vuoto (3-7 kPa assoluti) e della pompa di calore per ottenere l''ebollizione a bassa temperatura (25-40°C) della matrice. Prima del trattamento, l''effluente della seconda fase è stato filtrato con un setaccio a maglie di 0.5mm e successivamente pesato. I campioni di condensato, scaricato in continuo per troppo pieno, sono stati raccolti ad intervalli temporali predefiniti in 100 ml di acido solforico (2.5 M) e successivamente analizzati. L''analisi sui flussi di condensato restitutiva informazioni sulla quantità di azoto rimosso dalla matrice in entrata. Al termine di ogni prova l''effluente di concentrato è stato pesato e caratterizzato. Complessivamete sono state condotte 6 set di prove: tre di queste hanno avuto la durata complessiva di circa 4 ore mentre le altre 3 hanno avuto la durata complessiva di un''ora. L''effluente concentrato nel set relativo alle prove che hanno avuto la durata di un''ora è stato utilizzato, opportunamente diluito, come flusso di ricircolo in una sperimentazione su scala di laboratorio in cui sono state simulate le condizioni operative della sperimentazione su scala pilota, volta a definire se a seguito del trattamento la matrice mantenesse la capacità tamponante. 54 4.1.5 Analisi molecolare (PCR-DGGE)
La tecnica elettroforetica DGGE (Denaturing Gradient Gel Electrophoresis) permette di separare, lungo un gradiente di denaturante chimico, dei frammenti di acidi nucleici aventi uguale lunghezza, sfruttando le sole differenze a livello di sequenza nucleotidica. In particolare tale metodica costituisce un utile mezzo per seguire l''evoluzione di un consorzio microbico sia nello spazio che nel tempo. L''approccio per caratterizzare le comunità microbiche in studio si basa sull''analisi del profilo di DGGE per specifiche regioni ipervariabili V3 del gene 16S rDNA, amplificate a partire dal DNA totale estratto dalla matrice da analizzare. Nei geni 16S di Eubatteri si trovano anche zone altamente conservate, in base alle quali sono stati disegnati i primer per amplificare i frammenti ipervariabili. Il 16S rDNA costituisce una sorta di cronometro molecolare dei procarioti ed è molto utilizzato per le classificazioni microbiche. La divergenza tra le sequenze di DNA ribosomiale 16S di differenti specie rappresenta un indicatore di diversità, infatti tali frammenti consentono di operare distinzioni non solo a livello di genere ma addirittura di specie. Nelle banche dati è depositato un numero enorme di sequenze 16S, che rendono questo gene un marcatore molecolare ideale per analisi comparative al fine di ricostruire relazioni filogenetiche tra organismi procarioti. La PCR-DGGE applicata alle regioni ipervariabili del 16S rDNA permette di identificare nella matrice la presenza e la relativa abbondanza, di popolazioni microbiche differenti. Così al termine della corsa si saranno ottenuti una serie di fingerprinting elettroforetici ed ogni banda evidenziata dal profilo di DGGE corrisponderà ad una determinata specie. Tuttavia la DGGE non è in grado di evidenziare popolazioni presenti nella matrice in percentuale inferiore all''1% (Muyzer et al., 1993). Il principio che sta alla base di questa tecnica di fingerprinting richiede l''utilizzo di un gel di poliacrilamide con gradiente denaturante, creato con l''ausilio di due agenti in grado di spezzare i legame idrogeno tra le basi appaiate e dunque fondere il double strand di DNA: l''urea e la formammide. Durante la corsa elettroforetica i due filamenti complementari del double strand si separano man mano che aumenta la concentrazione di denaturante lungo il gel. Il meccanismo che viene sfruttato per la separazione in gradiente denaturante fa si che ciascun amplicone arresti la propria corsa una volta raggiunto il proprio punto di melting. Tale termine è in funzione della percentuale in GC del DS. I vari prodotti di PCR si disporranno in diverse posizioni di equilibrio lungo il gradiente denaturante, in funzione delle proprie sequenze nuleotidiche. Tuttavia se il DS fosse sottoposto a melting completo si otterrebbero due emieliche che correrebbero verso il fondo, vanificando la separazione elettroforetica. Al fine di evitare questo inconveniente viene usata ''clamp'' ricca di GC, una regione di 40 bp recata in 5'' da un primer forward opportunamente modificato. Essa viene co-amplificata durante la reazione di PCR precedente alla separazione elettroforetica e incorporata nell''amplicone. In pratica tale sequenza funge da dominio ad alta 55 temperatura di melting, in grado di impedire la completa dissociazione dei filamenti di DNA in molecole a singolo filamento. Estrazione del DNA totale dalla matrice: Il procedimento di estrazione è stato realizzato con l''ausilio del KIT FAST DNA® Spin Kit for soil (MO BIO, Carlsbad, CA), seguendo le istruzioni del produttore. Reazioni di PCR: Come descritto precedentemente, l''analisi PCR-DGGE è stata condotta sulle regioni ipervariabili V3 del 16S rDNA degli Eubatteri. Sono state quindi eseguite in successione due differenti reazioni di PCR, a partire dal DNA totale estratto dalla matrice: la prima per l''intero gene altamente conservato 16S rDNA e la seconda (nested PCR) per la regione ipervariabile V3. Tutte le reazioni di PCR sono state condotte in presenza di un controllo negativo (K-), al fine di verificare l''assenza di contaminazione da DNA. Le corse elettroforetiche per il controllo di avvenuta amplificazione sono sempre state eseguite su gel d''agarosio contenente Etidio Bromuro, utilizzando il tampone di corsa TAE 1X. Come marcatore ci si è serviti del 1Kb e del 100bp DNA ladder (New England Biolabs). Tutti i primer utilizzati sono stati forniti da Sigma-Genosys (Milano, Italia). L''enzima di cui si è serviti per tutte le reazioni di amplificazione è Taq DNA polimerasi, Promega (Madison, WY USA), che non presenta attività di ''proofreading'' e dunque decrementa la fedeltà di replicazione. Tale enzima ha una permanente attività di adenilazione intrinseca, in quanto aggiunge adenine all''estremità 3'' del frammento amplificato. Il risultato è l''ottenimento di sticky ends, caratteristica sfruttata per promuovere la ligazione di un vettore linearizzato all''amplicone, al fine di ottenere il costrutto desiderato. Amplificazione del gene 16S rDNA: L''amplificazione selettiva dei geni eubatterici 16S rDNA è stata realizzata utilizzando i Primer universali F8/R11. R11 5''-ACGGCTACCTTGTTACGACT-3'' F8 5''-GAGTTTGATCCTGGCTACG-3'' 56 Programma di reazione: Denaturazione iniziale 94°C per 2 minuti 30 cicli Denaturazione 94°C per 45 secondi 30 cicli Annealing 50°C per 30 secondi 30 cicli Estensione 72°C per 2,5 minuti Estensione Finale 72°C per 5 minuti Miscela di reazione standard: COMPONENTI VOLUME (µl) Templato 2 Buffer (5X) 5 Primer R11 (10pmlo/µl) 1 Primer F8 (10pmlo/µl) 1 dNTPs (10mM) 1 Taq DNA Polymerase (5U/µl) 0.2 H2O milli-Q 14.8 TOTALE 25 L''amplificazione selettiva dei geni 16S rDNA degli Archea è stata realizzata utilizzando i Primer A109-f e A934br (Grosskopf et al., 1998). A109-f 5''-ACKGCTCAGTAACACGT -3'' A9324br 5''-GTGCTCCCCCGCCAATTCCT-3'' Amplificazione della regione ipervariabile V3: Il gene 16S rDNA amplificato è stato sottoposto ad un ulteriore reazione di PCR, per l''ampificazione della regione ipervariabile V3. Per ciacun campione sono state predisposte 6 reazioni di nested PCR i cui prodotti saranno uniti tra loro al fine di incrementare la quantità di materiale genetico per la DGGE. L''obbiettivo è quello di ottenere almeno 1µg di DNA per campione per la separazione elettroforetica in gradiente denaturante. 57 La nested PCR per l''amplificazione della regione V3 degli eubatteri è stata condotta utilizzando i primer universali P3 (GC clamp) e P2 (Muyzer et al.,1993); per gli Archea l''amplificazione è stat condotta sulle regioni ipervariabili V2-V3 usando primers A109(T)-f E 515-GC-r. EUBATTERI P3 (con GC-clamp) 5''-(40bp GC)CCTACGGGAGGCAGCAG-3'' P2 5''- ATTACCGCGGCTGG-3'' ARCHEA AA109 (T)- f (con GC-clamp) 5'' '' (450bp) ACTGCTCAGTAACACGT-3'' 515-GC-r 5'' '' (450bp GC) ATTGTATTACCGCGGCMGATGGCAC -3'' La miscela di reazione corrisponde, nelle proprie componenti e nelle relative proporzioni, a quella utilizzata per l''amplificazione del gene 16S rRNA, ad eccezione dei primer. La concentrazione dei primer prelevati è pari a 10 pmoli/µl. Programma di reazione: Eubatteri Denaturazione iniziale 94°C per 2 minuti 35 cicli Denaturazione 94°C per 45 secondi 35 cicli Annealing 57°C per 30 secondi 35 cicli Estensione 72°C per 35 secondi Estensione Finale 72°C per 5 minuti Purificazione e Quantificazione del DNA amplificato: Gli ampliconi necessitano di purificazione prima di poter essere sottoposti ala separazione mediante DGGE. Le 6 mix di reazione allestite per ciascun campione sono state unite prima della precipitazione. Il DNA è stato precipitato in presenza di acetato di sodio 3M ed etanolo assoluto e lavato con etanolo al 70%, per poi essere risospeso in H2O deionizzata. La comparazione semi-quantitativa tra i diversi profili di DGGE richiede il caricamento su gel di uguali quantità di prodotti di PCR. Dunque è stato necessario quantificare il DNA dei vari campioni amplificati al fine di determinare i volumi da prelevare. I prodotti di PCR purificati sono stati quantificati mediante il marcatore 100bp in gel di agarosio al2%. Verrà caricato 58 su gel circa 1 µg di DNA per campione, quantitativo sufficiente per ottenere profili DGGE accettabili. Preparazione gel di poliacrilamide: La separazione elettroforetica delle regioni amplificate è stata condotta in presenza di un gel all''8% acrilamide/bis-acrilamide 19:1 (Biorad), in presenza di un gradiente denaturante 30-60% creato con un gradientatore. Il gradiente è crescente dall''alto verso il basso nel gel. Il 100% delle condizioni denaturanti è stato definito per soluzioni composte da urea 7M e formammide 20% (V/V). per la polimerizzazione del gel di poliacrilamide sono stati aggiunti ad entrambe le soluzioni 55 µl di TEMED 99% (TEtraMetyl Etilene Diamine, Sigma) e 88 µl di APS (AmmonioPerSolfato 10% W/V, Biorad). Corsa elettroforetica e colorazione: Per questo studio la corsa è stata effettuata a 45V per 18 ore, alla temperatura costante di 65°C in 7 litri di soluzione tampone TAE 1X. Per la DGGE ci si è serviti del Dcode' Universal Detection System (Bio-Rad). Il gel è stato colorato con EtBr (1 mg/L) e la relativa immagine acquisita con il software AB. EL CAT con CAMERA CONTROL, version 2.0.0 Eluizione delle bande da gel di poliacrilamide: Dopo essere state excise, le bande di profilo aventi un certo interesse sono state poste in appositi microtubi contenenti 50 µl di H2O sterile deionizzata. Il trattamento è stato eseguito overnight a 37°C, in agitazione costante a 200 rpm. Clonaggio: Preparazione di cellule competenti di E.Coli XL1blue con CaCl2: Per la preparazione di cellule competenti con CaCl2 è stato seguito l''apposito protocollo. Tale metodo offre un''efficienza di trasformazione elevata: 5*106 '' 2*107 colonie trasformate per µl di DNA plasmidico superavvolto. Tuttavia solo il 3-10% delle cellule trattate con CaCl2 sono generalmente rese competenti. L''inoculo iniziale deve essere realizzato in assoluta sterilità e va calibrato in funzione della densità cellulare della sospensione di partenza. La massima resa in cellule competenti viene raggiunta se il trattamento con CaCl2 è applicato ad una popolazione batterica in intensa attività metabolica, prossima al punto di flesso della curva di crescita. Occorre quindi monitorare periodicamente la densità ottica della sospensione a 600 nm, al fine di arrestare la proliferazione batterica in corrispondenza di una densità cellulare di 1-4*10 8 cellule/ml. La OD 600 ottimale del mezzo si aggira tra 0.2 e 0.4, a seconda del ceppo. Il protocollo per la preparazione delle competenti prevede poi centrifugazioni e passaggi in soluzioni di CaCl2, che provocano l''indebolimento della membrana plasmatica. Per evitare stress ulteriori, i batteri vengono mantenuti in ghiaccio durante i vari step. 59 Le aliquote di cellule competenti prelevate dalla sospensione originale vengono conservate a -80°C in presenza di glicerolo, per ostacolare la cristallizzazione delle membrane. Per valutare l''efficienza di trasformazione si opera un controllo positivo trasformando le cellule competenti con una quantità nota di plasmide circola rizzato superavvolto e contando le colonie sviluppate su terreno selettivo. Preparazione del frammento di interesse: Le bande di DGGE eluite sono state ri-amplificate per ottenere l''amplicone separato. In questo specifico caso i primer utilizzati risultano essere privi della GC-clamp, per motivi legati alla buona riuscita del sequenziamento. Il programma e la miscela di reazione corrispondono a quelle descritte in precedenza. Al termine dell''amplificazione si è operato il controllo mediante corsa elettroforetica e, dopo essersi accertati della presenza di una banda netta, si procede alla reazione di ligazione senza ulteriori passaggi di purificazione e quantificazione. Preparazione del costrutto: Questa fase prevede la ligazione di un vettore alla regione di interesse. Per i clonaggi ci si è serviti del pGEM ®-Teasy vector della Promega, non rivenduto in forma chiusa ma già linea rizzato. La de fosforilazione delle estremità 5'' impedisce al plasmide di chiudersi su se stesso (ligatura intramolecolare),in quanto la ligasi può agire solo unendo il vettore a un frammento che fornisce estremità fosforilate. Inoltre l''aggiunta di timine alle terminazioni 3'' del plasmide linea rizzato ne favorisce la circolarizzazione mediante inserimento di frammenti amplificati con la Taq polimerasi (ligatura intermolecolare). L''appaiamento delle timine terminali con le adenine recate alle due estremità 3'' dell''inserto amplificato comporta un aumento dell''efficienza di ligazione, indotto dal ravvicinato posizionamento dei frammenti da ligare. Il pGEM ®-Teasy vector reca siti di appaiamento per i primer M13 FOR e REV, i quali permettono l''amplificazione dell''inserto. Questo vettore porta anche la regione α del gene lacZ, che codifica per il frammento N-terminale dell''enzima β-galattosidasi. Alcuni ospiti, come E.Coli, recano un gene codificante l''altra sub unità dell''enzima, consentendo una complementazione che rende funzionale la β-galattosidasi. Il multiple cloning site del vettore è inserito nel gene lacZ e se viene interrotto da un frammento estraneo non consente di codificare un enzima funzionale. ' così possibile eseguire uno screening white/blue delle colonie trasformate. Inoltre il vettore possiede una regione codificante per la β-lattamasi,che conferisce resistenza all''ampicillina. Sono presenti anche un''origine di replicazione ori e una f1 di un fago filamentoso. La dimensione del plasmide così come viene commercializzato è di 3000bp. Un rapporto stechiometrico inserto:vettore accettabile per la ligazione è maggiore di 3:1, secondo le istruzioni del produttore, sebbene l''efficienza di reazione non raggiunga mai il 100%. I volumi da noi utilizzati rispettano tale range. La reazione di ligazione, svoltasi con l''ausilio dell''enzima DNA- 60 T4 ligasi, Promega (Madison, WI USA), è stata condotta overnight alla temperatura di 4°C. Ciò ha permesso di ottenere, alla fase successiva, il massimo numero di cellule trasformate, in accordo con le istruzioni del produttore. Miscela di reazione: COMPONENTI VOLUME (µl) Vettore p-Gem.T easy (25ng) 0.5 Buffer 2X 5 Ligasi T4 (3U/µl) 1 Inserto 3.5 TOTALE 10 Trasformazione di cellule competenti di E,Coli XL blue: Per l''individuazione dei vettori recanti l''inserto è stato necessario operare uno screening dei prodotti di ligazione. I plasmidi sono quindi stati inseriti in cellule in grado di riceverli, le cosiddette cellule competenti, mediante trasformazione con il metodo heat shock. La trasformazione è tanto più difficile quanto più grosso è il plasmide da incorporare. Le competenti prelevate dal refrigeratore a -80°C sono state lasciate in ghiaccio per circa 20 minuti, in modo da mantenere elevata la vitalità e la competenza delle cellule stesse. Successivamente si è addizionato il prodotto di ligazione (5 µl) e il tutto è stato mantenuto a riposo per 30 minuti in ghiaccio. Come da protocollo, la miscela è stata posta a 42°C nel bagnetto per 35 secondi, e poi in ghiaccio per 2 minuti. Le cellule poi sono state fatte crescere in 1 ml di terreno SOC a 37°C in agitazione per un''ora, al fine di incrementare la biomassa per lo screening colorimetrico. Screening colorimetrico e controllo dei falsi positivi: La fase di screening permette di identificare e selezionare le cellule recanti il costrutto con l''inserto. La semina su piastra viene eseguita su terreno LB Agar, Ampicillina (100 µg/ml), X-gal (32 µg/ml) e IPTG (32 µg/ml in piastra). Le piastre sono infine state incubate a 37°C per un periodo non inferiore alle 16 ore. L''utilizzo di un terreno selettivo contenente Ampicillina ha reso possibile la discriminazione tra cellule trasformate e cellule prive del vettore. Lo screening bianco/blu consente invece di verificare la presenza o meno di plasmidi ricombinanti, in quanto non tutte le cellule trasformate recano il frammento di interesse. ' possibile che eventi di ligazione intramolecolare abbiano generato vettori non ricombinanti,che tuttavia conferiscono alle cellule trasformate resistenza all''Ampicillina. In aggiunta, la mancata circolarizzazione porta a plasmidi linearizzati non ricombinanti,che presentano però un''efficienza di trasformazione decisamente più bassa rispetto a quella dei vettori chiusi. Con lo screening 61 colorimetrico si riesce ad ovviare a tutti questi inconvenienti. Tale metodo discriminativo sfrutta il prodotto del gene lacZ che in presenza di terreno con X-gal e IPTG consente di distinguere le colonie recanti l''inserto (bianche) da quelle che ne sono prive (blu). A conferma di ciò abbiamo realizzato un controllo dei falsi positivi mediante colony PCR (PCR da colonia) con primer M13 FOR e REV. M13 FOR 5''-GTAAAACGACGGCCAGT-3'' M13 REV 5''-AACAGCTATGACCATG-3'' Il programma e la miscela di reazione sono standard. Per tale amplificazione ci si è serviti dei primer M13 forward e M13 reverse alla concentrazione di 10pmol/µl. L''amplificazione è stata eseguita su 3 colonie bianche prelevate in sterilità da ogni piastra e stemperate ciascuna in una eppendorf contenente 30 µl di H2O; dalle miscele così formate sono stati prelevati 2 µl come templato. Altri 15 µl della miscela sono stati invece immessi in tubi da microbiologia assieme a 4ml di terreno LB non agarizzato contenente 4 µl di Ampicillina 100. Essi sono stati posti in camera di crescita a 37°C overnight, al fine di incrementare la biomassa delle colonie selezionate. In caso di conferma delle ipotesi di trasformazione, accertata mediante corsa elettroforetica degli amplificati su gel d''agarosio, si potrà procedere all''estrazione del plasmide a partire dalle colture. Estrazione del plasmide (miniprep): La procedura di estrazione del vettore da cellule trasformate è stata operata su 2 colonie selezionate da ciascuna piastra, coltivate in LB e Ampicillina dopo incubazione a 37°C overnight. Al termine della coltivazione si è operato un prelievo di 2 ml della sospensione. Per ottenere un pellet tale volume è stato sottoposto a centrifugazione per 30 secondi alla massima velocità di rotazione. I passaggi successivi sono indicati dal protocollo della WIZARD ® PLUS (Miniprep Kit). Il plasmide così ottenuto è pronto per il sequenziamento. DGGE di controllo: Come controllo è stata verificata l''effettiva corrispondenza tra la banda di DGGE tagliata in origine e quella ottenuta dal costrutto dopo amplificazione delle regione ipervariabili. Il gel è stato caricato con due replicati per campione, derivanti dal taglio di una singola banda successivi clonaggi. 62 Sequenziamento e analisi delle sequenze: Il sequenziamento delle regioni di interesse è stato realizzato presso il centro PRIMM Ospedale S. Raffaele di Milano, per mezzo di un sequenziatore Applied Biosystems Inc. (ABI), modello 377. Le sequenze ottenute sono state comparate a quelle registrate nelle banche dati, al fine di trovare omologie per l''identificazione delle specie microbiche in analisi. Sulla base del grado di similitudine è possibile ipotizzare una certa omologia tra due sequenze, ovvero una correlazione evolutiva tra le entità in studio. Per l''analisi ci si è avvalsi del sistema di interrogazione di banche dati biologiche dell''NCBI (National Center for Biotecnology Information) e della GeneBank (Database di sequenze nucleotidiche). Come algoritmo di allineamento è stato utilizzato BLAST (Basic Local Allignament Search Tool), per ricerche di sequenze nucleotidiche in banche dati (BLASTn). Per identificare correlazioni evolutive tra specie anche molto lontane tra loro è stato utilizzato un tool in grado di realizzare allineamenti multipli di sequenze chiamato CLUSTAL X versione 1.83 (Thompson et al., 1997). Il programma CLUSTAL W genera un profilo di multi allineamento, sfruttato per la costruzione di un albero filogenetico secondo le tecniche di clustering. L''albero mostra le relazioni evolutive delle specie microbiche dominanti presenti nella matrice considerata ed è stato costruito sfruttando come algoritmo il neighbour-joining method (Saitou and Nei, 1987) del software MEGA versione 4.0 (Molecular evolutionary genetics analysis). 4.1.6 Analisi delle popolazione batterica mediante FISH (Fluorescence In Situ Hybridization)
La tecnica FISH (Fluorescence in Situ Hybridization) è oggi una delle tecniche maggiormente utilizzate per monitorare le dinamiche di popolazioni microbiche nell''ambiente. Essa permette di identificare in situ la presenza di un''ampia varietà di microrganismi prescindendo dall''isolamento in coltura pura che spesso risulta difficoltoso e inattuabile. Per questo viene ampiamente utilizzata anche per individuare le popolazioni batteriche coinvolte nei processi delle acque reflue e rifiuti. Nel presente lavoro di tesi la tecnica FISH è stata utilizzata principalmente per studiare la popolazione Archea responsabile della produzione di metano nel processo di digestione anaerobica. Gli step principali per l''analisi del campione mediante tecnica FISH, sono raffigurati nella Figura 21: Fasi principali dell''analisi FISH 63 Fissaggio: Il fissaggio del campione si effettua immediatamente dopo il prelievo, seguendo la metodica di Amann et al. (1995). Ciò è essenziale per mantenere l''integrità morfologica delle cellule in seguito all''esposizione nel corso dell''ibridazione ad elevate temperature, a detergenti ed a gradienti osmotici. Inoltre il fissaggio del campione favorisce una maggiore permeabilità delle cellule alle sonde molecolari. Generalmente il fissaggio in paraformaldeide (soluzione al 4%) è più adatto per le cellule Gram negativo mentre per i campioni contenenti cellule Gram positive è necessario fissarne una aliquota anche con etanolo. Immobilizzazione e disidratazione del campione: per l''ibridazione in situ si utilizzano vetrini speciali rivestiti con materiale idrofobico (teflon) ad eccezione delle zone in cui viene posto il campione. Sono in commercio vetrini rivestiti in teflon con 6, 8 o 12 pozzetti in cui effettuare l''ibridazione. Ciò permette di tenere separati e quindi di analizzare più campioni sullo stesso vetrino. 8 μl di campione fissato vengono lasciati essiccare all''aria su ogni singolo punto di osservazione di tali vetrini. Le patine essiccate vengono in seguito disidratate immergendo il vetrino in successione per tre minuti in soluzioni di etanolo a concentrazione crescente (50, 80, 98%). I vetrini così trattati possono essere conservati indefinitamente.
Ibridazione in Situ: Per ogni reazione di ibridazione vengono aggiunti 10 μl di tampone di ibridazione e 1 μl di sonda molecolare alla concentrazione di 50ng/μl (fluos) o 30 ng/μl (cy3). Il vetrino viene quindi incubato a 46°C per due ore orizzontalmente in un tubo di polipropilene in cui è stata posta della carta imbevuta di tampone di ibridazione. Ciò viene fatto per evitare la concentrazione della soluzione di ibridazione per evaporazione ed il conseguente probabile legame non specifico delle sonde alle cellule. Il tampone contiene NACL 0,9M, Tris/HCl 20nM, SDS 0,01%, X% di formamide, pH 7,2. La quantità di formammide aggiunta nel tampone di ibridazione varia a seconda della sonda utilizzata e viene definita e fornita ogni qualvolta sono messe a punto nuove sonde molecolari. Lavaggio: Questo passaggio si rende necessario per rimuovere completamente le sonde molecolari che non si sono legate. La procedura prevede un lavaggio del vetrino in un tampone i cui componenti sono gli stessi utilizzati per il tampone di ibridazione (NaCl, Tris HCl, SDS) con l''eccezione della formammide. La concentrazione dei vari reagenti è costante (le concentrazioni finali sono le seguenti (Tris/HCl 20mM, SDS 0,01%), mentre varia la concentrazione di NaCl che è dipendente dalla stringenza (dalla concentrazione di formammide) utilizzata nella fase di ibridazione. Il tampone di lavaggio viene preparato in tubi di polietilene da 50 mL e viene preriscaldato in un bagno termostatico a 48°C. Dopo l''ibridazione il vetrino viene rimosso con cautela dal tubo, sciacquato immediatamente in un tampone di lavaggio e mantenuto immerso nel tampone per 15 minuti. Successivamente il vetrino viene lavato con dell''acqua distillata ed 64 immediatamente asciugato mediante getti di aria compressa per rimuovere ogni goccia d''acqua della superficie del vetrino. Sonde molecolari: Le sonde utilizzate hanno son segnate 5'' con un fluoro cromo (FITC e Cy3) (ThermoFisher). Gli oligonucleotidi modificati vengono generalmente acquistati alla concentrazione di 0,2 μmol e poi diluiti alla concentrazione di lavoro. In Tabella 11 sono riportate le sonde molecolari utilizzate, la sequenza nucleotidica, la percentuale di formammide per l''ibridazione e gli organismi target di ogni sonda.
Tabella 11: Sonde oligonucleotidiche utilizzate
Sonda Sequenza (5''-3'') FA (%) Organismi EUB338 GCT GCC TCC CGT AGG AGT 0-50 Bacteria domain FITC Arch915 GTGCTCCCCCGCCAATTCCT 35 Archea CY3 MX825 TCGCACCGTGGCCGACACCTAGC 50 Methanosaetaceae CY3 MS1414 CTCACCCATACCTCACTCGGG 50 Methanosarcinaceae CY3 hMS1395 GGTTTGACGGGCGGTGTG MS1414-helper - hMS1480 CGACTTAACCCCCCTTGC MS1414-helper - MB1174 TACCGTCGTCCACTCCTTCCTC 45 Methanobacteriaceae FITC MG1200 CGGATAATTCGGGGCATGCTG 30 Methanomicrobiacea+
metahnospirillacea FITC MC1109 GCAACATAGGGCACGGGTCT 45 Methanococcales CY3
65 4.2 Metodi per il confronto dei sistemi di pretrattamento della FORSU

Per la valutazione dei sistemi di pretrattamento della FORSU sono stati analizzati i flussi entranti e uscenti di quattro diverse piattaforme di trattamento dei rifiuti dislocate sul territorio europeo. Nella Tabella 12 sono riportate la tipologia di raccolta differenziata e rispettive tecnologie specifiche adottate per trattare i rifiuti prima dell''invio alla successiva sezione di stabilizzazione biologica. Tabella 12: Tecnologie di pretrattamento e metodi di raccolta della FORSU. Tecnologia Specifica Tipologia di raccolta Energia Specifica Impianto 1 Idropolpatore Alla fonte + porta a porta Alta Impianto 2 Presso estrusore Porta a porta Bassa Impianto 3 Separatore a umido Cassonetti centralizzati + porta a porta Bassa Impianto 4 Mulino a martelli Porta a porta Bassa
La scelta è ricaduta su quattro tecnologie di preselezione rifiuti, tra le più diffuse sul mercato, installate in altrettante piattaforme di trattamento in cui si presupponeva venissero conferiti la stessa tipologia di rifiuto per via delle simili strategie di raccolta differenziata adottate a monte del conferimento. Per gli IMPIANTI 2 e 4 il tipo di raccolta adottata era un ''porta a porta'' puro, mentre per l'' IMPIANTO 1 una quota dei rifiuti proveniva da raccolta differenziata effettuata alla fonte (in grandi utenze come supermercati, hotel, ecc.). Infine per l''IMPIANTO 3 una frazione dei rifiuti conferiti proveniva da una raccolta in cassonetti centralizzati, quindi con un più elevato grado di contaminanti. Le quattro tecnologie specifiche di pretrattamento oggetto di studio sono state: idropolpatore; presso estrusore; separatore ad umido e mulino a martelli accoppiato ad un vaglio a schermo fisso. Tutte le filiere di pretrattamento ad eccezione di quella relativa all''Impianto 1 sono caratterizzate da bassi consumi specifici. A monte di ogni tecnologia specifica, fatta eccezione per l''Impianto 4 sono presenti operazioni unitarie disposte in serie svolte da installazione elettromeccaniche tipiche delle più comuni linee preselezione dei rifiuti, quali: - Rompisacchi e trituratori primari per la dilacerazione del rifiuto conferito. - Deferrizzatori per la rimozione di materiali ad alta e bassa densità magnetica. - Vagli dimensionali per la separazione di inerti e plastiche. Al contrario caratteristica dell''Impianto 4 è che il materiale conferito viene caricato direttamente in un''unità compatta in cui il rifiuto mediante un mulino rotante a coltelli è pressato su un vaglio fisso con fori da 18mm. La porzione biodegradabile viene poi inviata ad un selettore ad umido in cui si sfrutta la differenza di densità del materiale organico per effettuare un''ulteriore separazione prima 66 della digestione, mentre la frazione secca rimane all''interno del vaglio e successivamente raccolta in un apposito container. Qui di seguito vengono riportate le caratteristiche generali degli impianti in esame.

Impianto 1.
L''impianto è stato progettato per processare circa 40000 tonnellate all''anno di rifiuto differenziato. La sezione di digestione anaerobica è rappresentata da un sistema a doppia fase termofila. Le sezione di trattamento dei rifiuti prevede due linee in base alla qualità dei rifiuti conferiti: nella prima linea detta ''wet'' vengono recapitati rifiuti proveniente dalle mense e da piccoli negozi alimentari: la seconda linea detta ''dry'' è stata concepita per accogliere rifiuti con un più alto grado di contaminanti. In questa linea il tipo di rifiuto proviene da grosse utenze quali ristoranti, hotels e supermarket. Nella ''wet line'' il rifiuto prima di essere caricato nel reattore di idrolisi viene dapprima setacciato e poi sottoposto all''azione di un mulino a coltelli. La linea dry prevede una setacciatura, una triturazione e prima di essere caricato nei digestori viene sottoposto all''azione dell''idropolpatore. I flussi di uscita dopo digestione anaerobica sono inviati ad un''unità di compostaggio.
Impianto 2.
L'impianto è stato progettato per trattare circa 90.000 t / a di RSU indifferenziati. Negli anni la strategia di raccolta rifiuti è stata modificata ed allo stato attuale nell''impianto vengono conferiti rifiuti provenienti da raccolta porta a porta. La linea di selezione prevede un trituratore monoalbero che funge anche da rompisacchi. Il materiale organico viene quindi alimentato nella pressa estrusore utilizzando un nastro trasportatore, dotato di un dispositivo di separazione ferroso. Il materiale in ingresso viene spinto nella camera di estrusione alla pressione di esercizio (287 bar), in queste condizioni la frazione organica è in parte liquefatta, passando attraverso i fori dell'estrusore. Un tamburo in lega speciale, costituito da tre cilindri, è posto al centro della camera, e viene fatto ruotare da un dispositivo oleodinamico. Il ciclo di trattamento è costituito da tre fasi: l'alimentazione, la compressione vera e l'estrazione. L'ultima fase è azionata da un cilindro secondario, che spinge la frazione secca respinta. Al momento della campagna di campionamento la sezione di stabilizzazione anaerobica era rappresentata da un''unità di compostaggio.
Impianto 3.
L''impianto è stato progettato per trattare circa 40 tonnellate al giorno di rifiuto a basso contenuto di contaminanti. La frazione organica dei rifiuti solidi urbani proveniente da raccolta differenziata sia porta a porta che su cassonetti da strada, prima di essere inviata al digestore, subisce una fase di trattamento per l''eliminazione degli inerti ( plastiche, vetro, metalli ecc.). L''intera filiera di pretrattamento del rifiuto solido è a basso consumo energetico, prerogativa di questo impianto. Il rifiuto conferito viene prelevato dalla fossa di conferimento mediante una benna e caricato nella tramoggia del trituratore primario ad alberi lenti, che libera il rifiuto 67 dall''imballaggio e lo sottopone a blanda triturazione. Il rifiuto viene in seguito trasportato mediante una coclea ad un nastro trasportatore all''estremità del quale è posto un deferrizzatore; il rifiuto privato dalla frazione ferrosa viene sottoposto a separazione da plastiche ed altri inerti mediante un vaglio a tamburo rotante. Il sottovaglio, ricco di materiale organico, viene trasportato ad un secondo trituratore dotato di lame di circa 10-15 mm di spessore per la riduzione di pezzatura; qui viene nuovamente deferrizzato, questa volta con un sistema adatto alla cattura dei materiali a permeabilità magnetica bassa. La biomassa viene così inviata ad un miscelatore/separatore, dove il contenuto in secco viene abbassato al 7-8% circa attraverso la miscelazione con i fanghi di supero; la parte flottante residua ed i fondami vengono separati e mandati alla sezione di grigliatura. La miscela così ottenuta viene trasferita poi in linea fanghi, previa ulteriore miscelazione con i fanghi di supero ed alimentata al digestore (volume 2200 m 3) operante in regime termico mesofilo. La linea di trattamento permette la rimozione del 99% del materiale ferroso mentre la rimozione totale per gli altri flussi (come plastica, inerti, ecc..) nell''intera linea è all''incirca del 90%. La potenza installata complessivamente nella linea è di 100kW Impianto 4: L''impianto tratta circa 20000 tonnellate annue di FORSU proveniente da raccolta differenziata porta a porta. Il digestore anaerobico opera in regime di co-digestione con fanghi di depurazione. A seguito di uno smistamento meccanico la linea di preselezione prevede una tecnologia integrata a basso consumo energetico un cui è presente un mulino a martelli accoppiato ad un vaglio fisso con fori da 18 fori mm. La FORSU viene spinta attraverso i fori e le frazioni secche ( legno, plastiche ecc.) rimangono intrappolate all''interno del un cestello che compone il mulino dal quale vengono poi inviate in un contenitore di raccolta per lo smaltimento finale. La frazione umida viene inviata ad selettore a umido simile all''impianto 3 in cui avviene la miscelazione con i fanghi si supero. L''attività di studio svolta interamente presso la stazione sperimentale dell''impianto di depurazione del comune di Treviso, ha previsto quattro campagne di campionamento relative alle 4 stagionalità annuali. I campionamenti prelevati erano relativi al: - Flusso di rifiuto tal quale conferito negli impianti - Flusso di scarti della filiera di preselezione - Flusso in uscita dal pretrattamento, quindi in entrata al digestore anaerobico Vi è da sottolineare che al momento della campagna di campionamento il digestore anaerobico dell''Impianto 3 era in costruzione e la successiva sezione di stabilizzazione biologica era rappresentata da un''unità di compostaggio. I flussi di ingresso e di scarto dei pretrattamenti sono stati analizzati dal punto di vista merceologico 68 secondo la procedura riportata dal manuale MODECOMTM 1998, in cui è prevista la classificazione del rifiuto in 13 categorie merceologiche. Al fine di effettuare una migliore interpretazione dei risultati , le 13 categorie sono state raggruppate nelle sei categorie riportate di seguito: - Frutta e verdura (rifiuti vegetali) - Rifiuti da cucina non vegetali (pasta, riso, pane, biscotti, carne, pesce ecc.) - Carta e cartoni - Plastiche - Inerti (ossa, gusci di uovo, semi,, vetro, metalli ecc.) - Materiale non classificato (< 20mm) La frazione di materiale non classificato era rappresentato da una componente dalla pezzatura ridotta (<20mm) caratterizzata da un parziale stato di degradazione, per cui non è stato possibile attribuire una specifica classe merceologica. L''analisi granulometrica è stata effettuata mediante un setacciatore ad umido della Retsch GmbH (Sieving Machine Type AS 200 Control) in accordo con la procedura riportata nel manuale APHA- AWWA-WEF, (2007). La durata dell''analisi granulometrica effettuata sui flussi in uscita da pretrattamenti di ciascun impianto è stata di 10 minuti alla velocità 50 vibrazioni al secondo. Le dimensioni dei setacci impiegati rientravano nel range 0.25 mm a 3.15 mm (Tabella 13) Tabella 13: dimensione dei setacci adottati nell''analisi granulometrica sul flusso OUTPUT Classe Frazione > 3.15 mm Grossolana da 2 a 3.15 mm da 1 a 2 mm da 0.5mm a 1 mm Media da 250M a 0.5mm < 250M Fine Le varie classi granulometriche sono state raggruppate ulteriormente in tre frazioni: GROSSOLANA (> 1mm); MEDIA ( da 250M a 1mm) e FINE (<250M). I tre flussi in esame sono stati analizzati in termini di solidi totali (TS) e solidi volatili (TVS), mentre la frazione secca del solo flusso in uscita dai pretrattamenti è stata analizzata anche in termini di domanda chimica d''ossigeno (COD) , azoto totale (TKN) e fosforo totale (P). Le procedure analitiche (TS, TVS, COD, TKN e P) sono state condotte tutte in accordo con gli Standard Methods (APHA-AWWA-WEF, 2007). 69 4.3 Materiali e metodi per la processo di co-digestione di matrici agroindustriali. 4.3.1 Reattori e condizioni operative
Per lo studio volto all''ottimizzazione dei processi di digestione anaerobica di matrici agroidustriali sono stati utilizzati 4 reattori CSTR di grossa taglia dal volume utile di 0.23m 3 (Figura 22). Figura 22: Reattori impiegati per il trattamento di matrici agroindustriali Ogni reattore è riscaldato autonomamente, con circuito idraulico dedicato, da un sistema di circolazione esterno ad acqua calda, azionato da resistenze elettriche. I sistemi di termostatazione agiscono in due fasi: misurando la temperatura interna del reattore (scarto +/- 1°C) utilizzando termoresistenze PT100 interfacciate ad un quadro comune, che agisce sulla pompa di circolazione dell''acqua del singolo reattore, ed inoltre a livello centrale, mantenendo costante la temperatura all''interno del serbatoio dell''acqua di ricircolo utilizzando una termocoppia dedicata. I digestori hanno operato in parallelo, adottando ciascuno differenti condizioni operative in termini di carico organico, tempo di residenza e temperatura (Tabella 14) Tabella 14: Condizioni operative dei reattori impiegati per trattamento di matrici agroindustriali Reattore (CSTR) T (°C) HRT (d) OLR (kgVS/m 3 rd)* R1 37 30 4-5 R2 37 30 2-3 R3 55 60 2-3 R4 55 30 4-5 RUN 1 EA (100%) RUN 2 EA(50%) + EC (50%) RUN 3 EA (50%)+ EC (50%)+AW(25%) EA: effluenti d''allevamento (letame + liquame) ; EC: energy crops (insilato di mais) AW: sottoprodotti vegetali (patate e cipolle). Le percentuali sono riferite al carico organico espresso in VS. 70 La scelta delle condizioni operative è stata dettata dalla necessità di voler simulare le tipiche condizioni di esercizio degli impianti in piena scala, come nel caso del reattore R2, il quale opera in regime termico mesofilo con un carico medio basso (di 2 kgTVS/m 3rd) e tempi di residenza dell''intero processo nell''ordine dei 60 giorni. Da qui il confronto con un reattore operante nello stesso regime termico e alimentato con un carico organico medio alto (OLR = 4 kgTVS/m 3 rd, raramente osservato in impianti industriali) e tempi di residenza di circa 30 giorni. Parallelamente sono stati avviati altri due reattori operanti nelle stesse identiche condizioni di esercizio in termini di carico organico applicato e tempi di residenza ma a regimi termici più elevati (55°C), anche questa scelta tecnologica raramente adottata a livello industriale. La campagna sperimentale è stata suddivisa in tre periodi caratterizzati da differenti matrici in ingresso ai reattori: nel RUN1 l''alimentazione era composta da solo liquame e letame bovino con un rapporto in peso di 1.5:1; nel RUN2 metà del carico in termini di VS è stato rimpiazzato con insilato di mais; nel RUN3 il 50% del carico era rappresentato da effluenti d''allevamento, il 25% da insilato e il restante 25% da sottoprodotti vegetali agricoli. Il monitoraggio dei reattori è stato condotto basandosi su metodiche ufficiali IRSA-CNR e Standard Methods APHA, talvolta opportunamente modificate per tener conto della natura dei substrati in gioco. La portata di biogas è stata monitorata utilizzano opportuni contatori ad umido Rittel Drum Type Gas Meter, mentre la composizione è stata verificata utilizzando un analizzatore portatile tipo GA 2000 Gas Analyser (Geotechnical Instruments). 4.3.2 Substrati ed inoculo
Con cadenza settimanale, al momento del conferimento, i vari substrati venivano caratterizzati (Tabella 15) . Tabella 15: caratterizzazione dei substrati agroindustriali impiegati nel corso della sperimentazione A.V±S.D TS (g/kg) TVS/TS (%) COD (g/kgTS) TKN (g/kgTS) P (g/kgTS) N-NH4 + (mg/L) EA Liquame bovino 94±45 79±2 907±245 38±2 8±2 1950±450 Letame Bovino 310±35 80±3 835±201 49±3 6±0.5 - EC Triticale 251±51 90±1 1050±95 17±1 1.4±0.02 - Insilato di mis 347±54 96±1 1100±112 13±3 2.5±0.02 - AW Cipolle 107±15 93±0.5 940±85 27±1 3±0.02 - Potate 177±28 94±0.5 1000±89 23±1 2±0.02 - Le matrici utilizzate presentano caratteristiche tipiche (Weiland, 2010): il letame è caratterizzato da una concentrazione in termini di sostanza secca del 31%, per l'80% volatile, e con un rapporto COD/TS pari a 0,9. Il contenuto in azoto e fosforo è del 3% e 0.3%, rispettivamente. Il liquame 71 presenta invece un contenuto in sostanza secca di circa il 10%, per il 79% volatile, e con un rapporto COD/TS apri a 0.8. Il contenuto in azoto e fosforo è del 3.5% e 0.6%, rispettivamente. Gli effluenti d''allevamento appaiono quindi caratterizzati da un certo livello di ossidazione, in particolare il liquame, che non consente poi interessanti produzioni in termini di biogas. Gli energy crops e i residui vegetali sono stati caratterizzati da un''alta frazione di solidi volatili rispetto ai solidi totali (> 90%) ed un rapporto COD/TS superiore a 1. Il contenuto di azoto e fosforo negli energy crops era di circa 13-17gN/kgTS e 1.4-2.5 gP/kgTS rispettivamente. Mentre i sottoprodotti vegetali hanno evidezato in contenuto di azoto organico e di fosforo negli intervalli 23-27 gN/kgTS e 2-3 gP/kgTS, rispettivamente. Come previsto il liquame bovino era caratterizzato da un elevato contenuto di azoto ammoniacale (circa 2g/L). La tabella seguente riassume i valori delle di produzione specifica di biogas e le costanti d''idrolisi di primo ordine ottenute in prove batch preliminari condotte sui vari substrati mediante la procedura riportata da Angelidaky et al., 2009. Le prove sono state condotte sia in ambiente mesofilo (37°C), sia in ambiente termofilo (55°).
Tabella 16: Costanti di idrolisi e SGP ottenute mediante prove BMP condotte in mesofilia e in
termofilia (Frison 2010) SGP 37°C (m 3/kgTVS) Kd 37°C (d -1) SGP 55°C (m 3/kgTVS) Kd 55°C (d -1) EA Liquame bovino 0.18 0.13 0.18 0.12 Letame Bovino 0.22 0.12 0.23 0.13 EC Triticale 0.76 0.21 0.91 0.23 Insilato di mis 0.73 0.21 0.82 0.23 AW Cipolle 0.92 0.34 1.05 0.37 Patate 0.83 0.26 0.92 0.30 I risultati della tabella 16 mostrano che gli effluenti zootecnici non coportano delle rese interessanti in termini di biogas: esse infatti provengono già da processi di digestione pertanto contengono una quantità di carbonio disponibile molto bassa rispetto ad altri substrati. A conferma di ciò è pure la loro bassa costante d''idrolisi, il che rende questi substrati meno proni alla biodegradazione e di conseguenza quelli meno adatti alla produzione di biogas. D''altro canto esse rappresentano un importanto susbstrato per via dell''apporto di sia di nutrienti che di capacità tamponante nei processi di digestione anaerobica (Procházka et al., 2012). I più alti valori delle produzioni specifiche di biogas appartengono ai prodotti dell''agroindustria, caratterizzati pure da una buona degradabilità (0.83-0.90 m 3/kgTVS in mesofilia). A seguirli sono gli energy crops, con le classiche produzioni specifiche di biogas nell''intorno di 0.75 m 3/kgTVS. Il regime termico termofilo comporta circa un 10-15% di rese specifiche rispetto alla termofilia. 72 I reattori sono stati inoculati con il fango proveniente dal digestore primario presente in piena scala della suddetta azienda agricola la cui temperatura di esercizio è di 40°C. Per favorire le operazioni di carico è stato necessario diluire il fango. Terminato il carico dei quattro reattori è stata condotta una caratterizzazione completa del fango presente in ognuno di essi (Tabella 17). Tabella 17: caratterizzazione dell''inoculo dei reattori PARAMETRO R1 R2 R3 R4 TS (g/kg) 54±3,3 49±7,6 57±5,8 57±2,4 TVS (g/kg) 34±2,6 32±4,3 38±4,3 36±1,4 TVS, %TS 63 ±0,9 64±1,9 67±0,6 63±1,2 COD (gCOD/kgTS) 772±44,5 839±20,1 768±44,9 692±180,5 TKN (gN/kgTS) 28±4,3 32±1,3 35±6,1 31±1,1 PTOT (gP/kgTS) 4±1,2 3,5±0,9 4±1,7 5±1,6 VFA (mgCOD/l) 1140±253 840±140 700±125 1100±60 N-NH4 + (mgN/l) 4038±53 3550±0,1 3363±123 4208±87,8 pH 8,5±0,2 8,6±0,1 8,6±0,1 8,6±0,2 Alcalinità pH 6 (mgCaCO3/l) 8330±410 9050±380 6570±890 7713±339 Alcalinità pH 4 (mgCaCO3/l) 16940±650 15630±700 13470±1100 17093±608 Si tratta di un digestato caratterizzato da un tenore in sostanza secca del 5% circa, al 65% volatile, caratterizzato da un notevole livello di capacità tamponante: l'alcalinità totale si attesta su valori tra i 13 ed i 17 gCaCO3/L ed un pH di 8.6. Nel caso dei reattori termofili si è immediatamente impostata la temperatura a 55°C senza procedere all'alimentazione degli stessi così da dar modo all'adattamento di popolazioni batteriche termofile. 73 5. Risultati e discussione 5.1 Produzione di Biohythane: confronto tra i diversi carichi organici
5.1.1 RUN1

Durante il RUN1, nel reattore di dark fermentation è stato applicato un OLR medio di 16.1 kgTVS/m 3d, con un HTR di 3.3 giorni e una portata del flusso di ricircolo corrispondente alla metà della sua portata totale. Nello stesso tempo il reattore di metanogenesi è stato alimentato con l''effluente della prima fase con un carico medio di 4.2kgTVS/m3 rd e un HRT di 12.6 giorni. Nelle Figura 23 sono riportati i profili temporali dei VFA totali e a dei VFA catena corta (C2-C3- C4) durante il RUN 1. (A) (B) Figura 23: Profilo temporale dei VFA totali (A) e a catena corta (B) nella Dark Fermentation. Come si può notare la concentrazione di VFA all''interno del reattore si è mantenuta sotto i 3gCOD/L per circa 20 giorni, indice che ancora la biomassa si stava acclimatando alle condizioni d''esercizio. Dopo un periodo corrispondente a circa 6 HRT si è registrato un incremento delle attività di idrolisi/acidogenesi, come si può notare dall''aumento della concentrazione di acidi grassi volatili totali fino a un valore medio di 13.8gCOD/L. L''aumento dei VFA all''interno nella dark fermentation era dovuto essenzialmente alla produzione di acido butirrico (C4) e acido acetico (C2). L''alta produzione di C4 e C2 suggerisce che il metabolismo predominante in questa fase di processo, potrebbe essere quello indicato dalla reazione riportata qui di seguito in cui la produzione di idrogeno sarebbe catalizzata dai ceppi diversi ceppi quali ad esempio Clostridium acetobutylicum e Clostridium butyricum. 2 2 3 2 2 3 2 6 12 6 10 8 2 3 2 4 H CO COOH CH COOH CH CH CH O H O H C ' ' ' ' ' 0 2500 5000 7500 10000 12500 15000 17500 20000 0 5 10 15 20 25 30 35 40 45 VFA ( m gCOD/L ) Tempo (giorni) 0 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000 0 5 10 15 20 25 30 35 40 45 m gCOD/L Tempo (giorni) A.Acetico
A.Propionico
A.Butirrico
74 Dall''analisi critica della letteratura non esiste un rapporto ottimale C4/C2 univoco associato ad una massima produzione di idrogeno, in ogni caso i valori riscontrati rientrano nel range 0.5-2. Durante il RUN 1 allo stato stazionario il rapporto tra acido butirrico e acido acetico risultava essere di 1.5, con una concentrazione media di 6297mgCOD/L e 4193mgCOD/L rispettivamente. Nello stesso tempo la percentuale di idrogeno nel gas prodotto nel primo reattore ha fatto registrare valori medi del 35% (Figura 24). Figura 24: concentrazione di idrogeno (V/V) nel gas in uscita dal reattore della dark
fermentation
Nonostante la massiccia attività di acidogenesi , il pH del reattore fermentativo non ha subito una riduzione, ma al contrario assumendo nelle CSS del RUN 1 ha assunti valori superiori di circa un punto rispetto ai quello di partenza (Figura 25). Figura 25: Profilo temporale del pH nel rattore della dark fermentation. Come si evince dai grafici dopo circa 4 HRT il pH del reattore fermentativo si è stabilizzato all''interno del range ottimale (5-6) per l''attività delle idrogenasi, grazie alla forza tampone 0 10 20 30 40 50 60 0 5 10 15 20 25 30 35 40 45 % H 2 Tempo (giorni) 3,0 3,5 4,0 4,5 5,0 5,5 6,0 6,5 7,0 5 10 15 20 25 30 35 40 45 pH Tempo (giorni) 75 esercitata dal flusso di ricircolo proveniente dal reattore metanigeno, il quale era caratterizzato da un''alcalinità totale di circa 3-4 gCaCO 3/L (Figura 26). Figura 26: Profilo temporale dell''alcalinità totale e parziale nel reattore della metanogenesi. Sin dalle prime fasi di processo nel reattore della metanogenesi si è verificato un incremento dei parametri alcalinità parziale (pH 6) e totale (pH 4), caratterizzati da una differenza tra i loro valori pressoché costanti, indicando quindi un buon bilanciamento della catena trofica anaerobica. L''ottima sintrofia tra le due fasi di processo è stata confermata sia dalle basse concentrazioni di VFA (< 1gCOD/L) che dai costanti valori di pH intorno a 8 registrati nel reattore adibito alla produzione di CH4 (Figura 27). (A) (B) Figura 27: Profili temporali dei VFA (A) e del pH (B) nel reattore di metanogenesi. La capacità tamponante del mixed liquor del reattore di metanogenesi, e di conseguenza anche nel reattore della dark fermentation per via del ricircolo applicato, era dovuta in parte alla solubilizzazione dei gruppi amminici della componente proteica contenuta nella FORSU, come evidenziato dal profilo crescente della concentrazione dello ione ammonio in entrambi i reattori (Figura 28) e di cui si riporterà in seguito la correlazione con il parametro alcalinità. 0 2000 4000 6000 8000 10000 12000 0 5 10 15 20 25 30 35 40 45 Al cal in ità (mgCaCO 3/l parziale totale 0 1000 2000 3000 4000 5000 6000 7000 8000 0 5 10 15 20 25 30 35 40 45 VFA (m gCOD/l) Tempo (giorni) 6,0 6,5 7,0 7,5 8,0 8,5 9,0 0 5 10 15 20 25 30 35 40 45 pH Tempo (giorni) 76 (A) (B) Figura 28: Profilo temporale della concentrazione di N-NH4 + nel reattore della dark fermentation (A) e della metanogenesi (B) Come si può notare sin dalle prime fasi di processo in entrambi i reattori c''è stato un incremento costante della concentrazione di azoto ammoniacale. La velocità giornaliera di accumulo dello ione N-NH4 + è stata pari a 13 mg/ L d e 11mg/ L d rispettivamente per il reattore della dark fermentation e di metanogenesi. L''aumento della concentrazione di ammoniaca si riflette direttamente sulla capacità tamponante del sistema attraverso il meccanismo riportato da Procházka et al., (2012) in cui lo ione ammonio neutralizza l''effetto acidificante dei VFA presenti nel mezzo. La buona stabilità del processo nelle condizioni di esercizio del RUN 1 sono state confermate dalle interessanti performance registrate in termini di gas prodotto (Figura 29). (A) (B) Figura 29: RUN I, Dark fermentation: percentuale (A) e produzione specifica di idrogeno (B). Con riferimento specifico alle produzione specifiche di idrogeno (dark fermentation) e di biogas (metanogenesi), i due reattori hanno raggiunto una condizione di stazionarietà dopo circa 20 giorni di esercizio, corrispondenti a 1.3 HRT dell''intero processo. Vi è da sottolineare che la maggiore variabilità registrata nella produzione di idrogeno è attribuibile in primo luogo ai bassi tempi di residenza applicati nel reattore fermentativo il quale risente maggiormente del blocco delle operazioni di carico condotte nel fine settimana nonché all''eterogeneità del substrato. Nella Tabella seguente sono riportati i valori medi dei parametri monitorati sia nel reattore di dark fementation che in quello di metanogenesi riferiti alle CSS del RUN 1. 0 250 500 750 1000 1250 1500 1750 2000 0 5 10 15 20 25 30 35 40 45 N -NH 4+ (mg/ l) Tempo (giorni) 0 250 500 750 1000 1250 1500 1750 2000 0 5 10 15 20 25 30 35 40 45 N -NH4+ ( m g/L ) Tempo (giorni) 0,00 0,01 0,02 0,03 0,04 0,05 0,06 0,07 0,08 0,09 0 5 10 15 20 25 30 35 40 45 SHP (m 3H2/ kgTVS ) Tempo (giorni) 0,00 0,20 0,40 0,60 0,80 1,00 1,20 0 5 10 15 20 25 30 35 40 45 SG P (m 3/k gTVS ) Tempo (giorni) 77 Tabella 18: Valori medi e deviazione standard del RUN 1 nel reattori della dark fermentation
e metanogenesi.
Dark Fermentation Metanogenesi Parametro u.m. Media ± ds Media ± ds TS g/L 60±5 24 ±1 TVS g/L 49±5 16 ±1 TVS,TS % 81±3 67±1 tCODsecco g/L 40±8 12.8±3 TKN g/L 2±0.1 0.8±0.1 PTOT g/L 0.16±0.2 0.15±0.05 pH - 5.4±0.1 8.2±0.1 *N-NH4 + mg/L 535-1100 905-1320 N-NH4 + mg/Ld 13 11 VFA mgCOD/L 13877±1673 90±109 *Alcalinità Totale pH 4 mgCaCO3/L - 4500-6600 *Alcalinità Parziale pH 6 mgCaCO3/L - 2900-4200 RESE DI PRODUZIONE GPR m 3/m3d 2.04±0.61 2.8±0.2 H2 % 35±7 - CH4 % - 64±2 CO2 % 65 35±1 SHP m 3/kgTVS 0.05±0.02 - SGP m 3/kgTVS 0.13±0.04 0.68±0.07 * Poiché caratterizzati da un profilo crescente si riporta il valore iniziale e finale nel periodo di CSS preso in considerazione La concentrazione di solidi totali negli effluenti dei due reattori era del 6 e 2.5 % per reattore di dark fermentation e di metanogenesi rispettivamente. La frazione dei solidi volatili nell''effluente del primo reattore era l'' 81% dei solidi totali, mentre in misura nettamente minore tale frazione si presentava nell''effluente metanigeno (67%). I rapporti tra COD/TS nei due CSTR hanno evidenziato il maggior stato di ossidazione della fase di metanogenesi (0.54) rispetto a quella fermentativa (0.66). La diversificazione delle condizioni operative applicate nei due reattori di fatto ha portato allo sviluppo di flore batteriche dalle differenti attività metaboliche differenti. Tale aspetto viene confermato se si guarda alle differenti concentrazioni medie di VFA raggiunte ( circa 14gCOD/L per la dark fermentation e quasi nulla per la metanogenesi) e alla composizione del biogas. I valori medi della grado di produzione di gas e di produzione specifica nella dark fermentation sono state rispettivamente di 2.04 m 3/m3d e 0.13 m3/kgTVS, con una concentrazione ( V/V) media 78 di H2 pari al 35%. Mentre per il reattore di metanogenesi la velocità registrata è stata di 2.8 m 3 biogas/m 3d a cui è corrisposta una produzione specifica di 0.68 m3/kgTVS, ed un contenuto medio di CH4 pari al 64% ( V/V). Nella Tabella 19 sono riportati i bilanci di massa del RUN 1. Tabella 19: Bilanci di massa nel RUN1 PARAMETRO ENTRATA USCITA ABBATTIMENTO BILANCIO g/d g/d % % TS 3926 3694 63 - 6 TVS 3220 3213 70 - 1 PTOT 9.6 9 - - 6 NTOT* 118 127 - + 8 * Il bilancio è stato calcolato considerando la concentrazione di ammoniaca al termine del RUN 1 (1320mg/L). Dall''analisi dei bilanci di massa dell''intero processo risulta un abbattimento del 63% dei solidi totali, valore riscontrato tipicamente in approcci di digestione anaerobica che prevedono la separazione delle fasi tipiche della catena trofica anaerobica. Con riferimento specifico al bilancio di massa condotto sull''azoto totale , nel RUN 1 è risultato che circa il 62% dell''azoto in uscita dal reattore di metanogenesi era sottoforma di azoto ammoniacale (Figura 30). L''alto grado di solubilizzazione della componente proteica contenuta nel particolato organico dei substrati di partenza ha confermato la buona attività biologica della biomassa microbica che come abbiamo visto in precedenza ha portato a delle rese di processo molto interessanti. Figura 30: Distribuzione azoto nel flusso in entrata e in uscita nel RUN 1 0 20 40 60 80 100 120 Di stri b u zio n e Azoto (%) INGRESSO
O
USCITA N Organico N Solubile 79 5.1.2: RUN 2
Il RUN 2 è stato caratterizzato da un aumento del carico organico , il quale ha visto un valore medio nel reattore della dark fermentation di 21.1 kgTVS/m 3d. I tempi di residenza idraulici dei due reattori e la quantità di flusso di ricircolo sono rimasti costanti rispetti al RUN 1 Le operazioni di carico sono state condotte fino a giorno 83, momento in cui sono state bloccate per via di interventi d manutenzione straordinaria sulla linea di selezione della FORSU. L''attività sperimentale è ripresa regolarmente da giorno 93 con il RUN 3. L''effetto più evidente a seguito dell''aumento del carico nel reattore della dark fermentation è stata una variazione dell''attività di acidogenesi. Infatti dall''osservazione della Figura 31 è particolarmente evidente come la produzione di VFA ha subito una netta diminuzione facendo registrare una concentrazione media di circa 8gCOD/L dopo circa 5 HRT (giorni 45-60) dall''applicazione della nuova condizione operativa. Figura 31: Produzione di VFA durante il RUN 2 (dark fermentation) Nella primissima fase della variazione del carico (giorni 45-55), il decremento dei VFA era riconducibile in larga parte ad una riduzione della concentrazione di acido butirrico, mentre l''acido acetico si è mantenuto grosso modo sugli stessi livelli precedenti. Dal giorno 58 al giorno 63 si è assistito ad una netta riduzione sia dell''acido butirrico che dell''acido acetico, con un rapporto medio tra le loro concentrazioni di 0.7. Nello stesso arco di tempo più del 50% della produzione totale di VFA era dato da composti con un numero di atomi di carbonio superiore a 4. Ne consegue che il sistema ha denotato una certa sofferenza nel degradare i composti ad elevato peso molecolare. Subito dopo questa fase c''è stato nuovamente un incremento della produzione di acido butirrico ed acido acetico su livelli comunque inferiori rispetto al RUN 1 con concentrazioni medie di 2948 e 2659mgCOD/L, rispettivamente. 0 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000 0 15 30 45 60 75 90 mgCO D/L Tempo (giorni) A.Acetico A.Propionico
A.Butirrico
80 La netta riduzione dell''attività metabolica dei microrganismi fermentativi si è riflessa in una riduzione dell'' SHP (Figura 32) dovuta essenzialmente non ad una variazione del contenuto di idrogeno in termini percentuali ( Figura 33) percentuale ma bensì alla riduzione della quantità di gas in uscita il con una relativa velocità media di produzione pari a 1.22m 3/m3d. (Figura 32) Figura 32: Produzione specifica di idrogeno (dark fermentation) Figura 33: percentuale di idrogeno (dark fermentation) Figura 34: velocità di produzione di gas (dark fermentation) 0,00 0,02 0,04 0,06 0,08 0 15 30 45 60 75 90 S HP (m 3 H 2/k gTVS ) Tempo (giorni) RUN 1 RUN2 0 10 20 30 40 50 60 0 15 30 45 60 75 90 Com p osizion e gas (% H 2) Tempo (giorni) 0,00 0,50 1,00 1,50 2,00 2,50 3,00 3,50 4,00 0 15 30 45 60 75 90 G P R (m 3 /m 3 r d ) Tempo (giorni) 81 Per quanto riguarda il pH dei due reattori non si sono registrate particolai variazioni rispetto agli andamenti registrati nelle condizioni operative precedenti (Figura 35). Figura 35: Profilo temporale del pH nei due reattori (RUN2) Nonostante il basso HRT applicato nel reattore della dark fementation ( 3.3 giorni), che equivaleva a sostituire giornalmente un terzo del volume di reazione e a fronte di un dimezzamento della concentrazione dei VFA, il valore del pH si è attestato intorno a quello ottimale per la produzione di idrogeno, delineando da una parte una certa robustezza del sistema in termini di capacità tamponante e dall''altra una inadeguatezza del pH come parametro di controllo del processo. Nella Figura 36 è riportato il profilo temporale dell''alcalinità del flusso di ricircolo, resposabile maggiore del potere tamponante sul reattore fermentativo. Figura 36: andamento dell''alcalinità totale e parziale del flusso di ricircolo (RUN2). 3,0 4,0 5,0 6,0 7,0 8,0 9,0 10,0 11,0 12,0 0 15 30 45 60 75 90 pH Tempo (giorni) Dark Fermentation Metanogenesi 0 2000 4000 6000 8000 10000 12000 0 15 30 45 60 75 90 Al cal in ità (mgCaCO 3/l parziale
totale
82 Al momento della variazione del carico organico l''alcalinità totale aveva assunto valori superiori ai 6gCaCO3/L . Nella primissima fase del RUN 2, contrariamente a quanto osservato fino a quel momento, si è assistito ad un blocco della dei due paramentri calcolati a pH 6 e pH 4. Dopo circa 10 giorni i due parametri hanno ripreso a crescere facendo registrare intorno sessantesimo giorno d''esercizio anche un graduale incremento della loro differenza. Ciò è indice di un possibile accumulo dei VFA correlabile ad un riassetto del metabolismo microbico verso una nuova condizione di equilibrio. Di fatto questo aspetto è stato confermato dalla misura diretta dei VFA (Figura 37), dal cui profilo temporale si può notare un aumento della loro concentrazione media durante il RUN 2 comunque su livelli del tutto di sicurezza. Figura 37: profilo temporale dei VFA nel reattore di metanogenesi (RUN2) Vi è da segnalare che in corrispondenza degli ultimi giorni del RUN 2 si stava assistendo ad un ulteriore aumento della concentrazione di VFA che a sua volta ha comportato un incremento della forbice tra l''alcalinità totale e parziale. Come già anticipato per via di problemi che sono sopraggiunti sulla linea di preselezione della FORSU la sperimentazione è stata interrotta, per tanto non è stato possibile approfondire le causa del fenomeno di accumulo dei VFA nel reattore di metanogenesi. Nella Tabella 20 sono riportati i valori medi dei parametri monitorati durante le CSS del RUN 2. 0 1000 2000 3000 4000 5000 6000 7000 8000 0 15 30 45 60 75 90 V FA ( m gC OD/l) Tempo (giorni) RUN 1 RUN 2 83 Tabella 20: Valori medi dei parametri monitorati nei due reattori durante il RUN 2. Dark Fermentation Metanogenesi Parametro u.m. Media ± ds Media ± ds TS g/L 73±0.5 30±3 TVS g/L 59±1.7 19±2 TVS,TS % 80±1.8 64±1 tCOD g/L 50±1 17±1 TKN g/L 2.3±0.05 0.8±0.2 PTOT g/L 0.3±0.01 0.2±0.04 pH - 5.4±0.1 8.2±0.2 *N-NH4 + mg/l 1150-1600 1430-1750 N-NH4 mg/Ld 22 18 VFA mgCOD/L 8269±2119 649±122 Alcalinità Totale pH 4 mgCaCO3/L - 7549±416 Alcalinità Parziale pH 6 mgCaCO3/L - 3860±366 RESE DI PRODUZIONE GPR m 3/m3d 1.22±0.17 3.35±0.58 H2 % 34±6 - CH4 % - 65±2 CO2 % 66±5 35±2 SHP l/kgTVS 20±4 - SGP m 3/kgTVS 0.06±0.006 0.63±0.12 * Poiché caratterizzati da un profilo crescente si riporta il valore iniziale e finale nel periodo di CSS preso in considerazione L''aumento del carico organico a 21 kgTVS/m 3 rd nel reattore di dark fermentation ha comportato una riduzione di circa il 40% di VFA rispetto al RUN I facendo registrare una concentrazione media di 8269mgCOD/L, a cui è corrisposta una riduzione di circa il 60% sia della produzione specifica di H2 (0.02m 3H 2/kgTVS) che della velocità di produzione di gas (1.22m 3/kgTVSd). Sempre nel reattore della dark fermentation la concentrazione di TS in uscita si è attestata intorno a 73g/L con una frazione volatile paria al 80% dei TS, e con un rapporto COD/TS di 0.66. La concentrazione di solidi e il relativo rapporto con il COD sono risultati leggermente superiori rispetto al RUN1 così come l''azoto organico (2.3g/L) e il fosforo totale (0.3 g/L). Il pH e la percentuale di idrogeno hanno mostrato una sostanziale costanza mantenendosi grosso modo sui valori medi fatti registrare nel RUN 1. Per quanto riguarda l''effluente della fase di metanogenesi il contenuto di solidi si è attestato intorno al 3% con una frazione di volatili pari al 64% dei TS. Con riferimento specifico alla frazione secca, anche nelle condizioni di carico di 5.6kgTVS/m 3 rd l''effluente ha mostrato un alto grado di 84 ossidazione con un rapporto COD/TS di 0.56 e con una concentrazione sia di azoto organico che di fosforo inferiori all''1%. Per quanto riguarda i parametri di stabilità e le produzioni di biogas la fase metanogenesi ha mostrato una sostanziale costanza rispetto al RUN precedente evidenziando un lieve incremento della concentrazione media di VFA a cui è corrisposto una riduzione di circa il 7% della produzione specifica di biogas. Contrariamente alla produzione specifica, la velocità di produzione di biogas è aumentata fino a di 3.35m 3/m3 rd, facendo registrare un incremento del 20% rispetto al RUN precedente. Nella Tabella 21 sono riportati i bilanci di massa nel RUN 2. Tabella 21: bilancio di massa (RUN 2) PARAMETRO ENTRATA USCITA ABBATTIMENTO BILANCIO g/d g/d % % TS 5138 4511 65 - 12 TVS 4220 3851 73 - 9 PTOT 12.84 12 - - 7 NTOT* 154 153 - - 1 * Il bilancio è stato calcolato considerando la concentrazione di ammoniaca al termine del RUN 2 (1750mg/L). Dall''analisi dei bilanci di massa effettuati durante il RUN 2 risulta un abbattimento del 65% e 73% rispettivamente per i solidi totali e volatili, considerando che il bilancio non si chiude per il 12%, probabilmente dovuto a fenomeni di sedimentazione all''interno dei reattori. Con riferimento specifico all''azoto nel RUN 2 risulta che il 68% dell''azoto totale presente nell''effluente finale era in forma solubile. In modo analogo al RUN 1 la concentrazione di ammoniaca ha avuto un profilo crescente, ad eccezione del prime fasi in cui è stata applicata la nuova condizione operativa. Infatti, come per l''alcalinità (Figura 36), le primissime fasi del RUN 2 (giorni 45-60) sono state caratterizzate da un appiattimento della velocità di accumulo dello ione ammonio in entrambi i reattori, probabilmente dovuto ad un adattamento della popolazione microbica alle nuove condizioni operative. Sia il reattore della dark fermentation che quello della metanogenesi rispettivamente da giorno 68 e 73 hanno fatto registrare un nuovo incremento dell''ammoniaca con velocità di crescità pari a 22 e 18mg/Ld rispettivamente , fino a registrare al termine del RUN 2 una concentrazione di 1600 e 1750mg/L. 85 Figura 38: Profilo temporale dell''ammoniaca nel reattore della dark fermentation (sinistra) e della
mentanogenesi (destra) Considerando i valori del pH (8.22) e della Temperatura (55°C) all''interno del reattore di metanogenesi, la concentrazione di ammoniaca libera (FA: free ammonia) calcolata secondo la formula riportata da Angelidaki and Ahring (1994), era di 696 mg/L, quindi in prossimità del limite di inibizione (700mg/L) dei processi di biogassificazione riportato dagli stessi autori. Sulla base di considerazioni termodinamiche il meccanismo di inibizione dell''ammoniaca libera all''interno delle cellule si espleta attraverso il blocco delle reazioni che portano alla degradazione dell''acido propionico (Wiegant and Zeeman, 1986), con conseguente accumulo dello stesso nel digestore. A conferma di ciò in Figura 39 sono riportati i profili temporali dell''ammoniaca libera e dell''acido propionico nel reattore di metanogenesi. Figura 39: Profilo temporale dell''ammoniaca libera e dell''acido propionico ( metanogenesi) Come si po'' notare alla fine del RUN 1 la concentrazione di ammoniaca libera era nel range dei 300-400mg/L a cui corrispondeva una concentrazione quasi nulla di acido propionico. Nel RUN 2, al superamento della soglia dei 400mg/L, c''è stato un incremento della concentrazione di propinato fino ad un valore medio di 460mgCOD/L. Di conseguenza l''accumulo di VFA al termine del RUN 2 evidenziato nella Figura 37 potrebbe essere dovuto all''insorgere di fenomeni di inibizione a causa delle alte concentrazioni di ammoniaca. Inoltre tale aspetto conferma quanto riportato da Nielsen 0 250 500 750 1000 1250 1500 1750 2000 0 15 30 45 60 75 90 N -NH4+ ( m g/l ) Tempo (giorni) 0 250 500 750 1000 1250 1500 1750 2000 0 15 30 45 60 75 90 N -NH4+ ( m g/L ) Tempo (giorni) 0 1000 2000 3000 4000 5000 6000 0 100 200 300 400 500 600 700 800 900 1000 0 15 30 45 60 75 90 Acido Pr oio nico (mg COD /L ) Ammo niaca Li bera (mg/L) Tempo (giorni) FA
Acido Propionico
86 et al., (2007) in cui viene evidenziato il ruolo dell''acido propionico come parametro chiave per l''identificazione preventiva di possibili fenomeni di inibizione nei processi di biogassificazione. Il ruolo dell''ammoniaca sull''intero processo verrà approfondito nei paragrafi successivi in cui saranno discussi i risultati relativi alla valutazione della stabilità a lungo termine del processo di produzione di bio-hythane, .

































87 5.1.3: RUN 3

Gli effetti del blocco delle operazioni di carico nella dark fermentation si sono manifestati in una riduzione dei VFA al disotto dei 3gCOD/L (Figura 40) , dovuta ad una loro degradazione da parte dei microrganismi tipici della fase finale della catena trofica anaerobica. Infatti parallelamente al consumo dei VFA si è assistito ad un incremento della percentuale di metano nel gas prodotto nel reattore fermentativo (Figura 41). L''attività dei microrganismi metanigeni è stata favorita dal bilanciamento del pH verso valori superiori al 6 (Figura 42), come c''era da aspettarsi al seguito della riduzione di acidità (consumo VFA). Figura 40: Andamento dei VFA durante il RUN3 nel reattore della dark fermentation.


Figura 41 : composizione del gas in uscita dalla dark fermentation durante il RUN 3. 0 2500 5000 7500 10000 12500 15000 17500 20000 22500 25000 60 75 90 105 120 135 150 VF A (m gCO D/ L ) Tempo (giorni) RUN 2 STOP RUN 3 0 20 40 60 60 75 90 105 120 135 150 Com pos izio ne ga s (% ) Tempo (giorni) H2 CH4 RUN 2 STOP RUN 3 88 Figura 42: Profilo temporale del pH nel reattore della dark fermentation durante il RUN 3 La strategia adottata nelle prime fasi del RUN 3 per ristabilire le condizioni antecedenti al blocco, quindi inibire l''attività di metanogenesi nel reattore di dark fermentation, è stata quella di applicare alti carici organici ( >21kgTVS/m 3d ) e sospendere momentaneamente il flusso di ricircolo. In queste condizioni operative (giorni 93-105) si è assistito ad una ripresa dell''attività fermentativa (Figura 40) e ad un incremento della percentuale di idrogeno nel gas prodotto (Figura 41). Nonostante gli alti OLR applicati, l''attività di metanogenesi all''interno del reattore fermentativo non è mai cessata completamente per via della presenza di metano che si è protratta per l''intera durata del RUN 3. Inoltre l''azione di inibizione era sfavorita dalla sospensione del carico durante il fine settimana, dove l''aumento dei tempi di residenza portava ad una riduzione della concentrazione di H2 ed un parallelo incremento della percentuale di metano (~ 40% V/V). Questo potrebbe indicare l''acclimatazione all''interno dei reattore di microrganismi metanogeni idrogenotrofi. Alla ripresa delle operazioni di carico il pH ha fatto registrare una momentanea riduzione (Figura 42), favorita dal fatto che era stato interrotto il flusso di ricircolo dalla fase di metanogenesi. Nonostante le azioni intraprese momentaneamente per ripristinare le condizioni antecedenti al blocco, alla ripresa delle condizioni operative previste dal piano di lavoro (÷18kgTVS/m 3 rd da giorno 105 in poi e adozione del ricircolo), il pH si è riequilibrato su valori superiori a 6, nonostante l''intensa produzione di VFA che aveva raggiunto valori superiori a quelli registrati nel RUN 2. Quindi la riduzione della percentuale di idrogeno rispetto ai RUNs precedenti può essere legata al fatto che il pH si è allontanato dal valore ottimale per l''attività delle idrogenasi, favorendo nello stesso tempo l''attività degli idrogenotrofi. Gli effetti del blocco si sono ovviamente manifestati anche nel reattore di metanogenesi. L''aumento dei tempi di residenza dovuti al blocco, che equivale ad aumentare i tempi di contatto tra il substrato e i microrganismi, ha comportato un consumo dei VFA (Figura 43) rispetto alla 4,0 5,0 6,0 7,0 60 75 90 105 120 135 150 pH Tempo (giorni) RUN 2 STOP RUN3 89 concentrazione registrata subito prima del blocco (1143mgCOD/L), con conseguente riduzione della differenza tra alcalinità totale e parziale. Figura 43: Profilo temporale dei VFA totali nel reattore di metanogenesi durante il RUN 3. Come si può notare alla ripresa delle operazioni di carico c''è stato un incremento della produzione di VFA. In particolar modo la biomassa metanogena ha denotato una certa sofferenza nel degradare l''acido propionico, che come già anticipato può essere all''effetto inibitorio esercitato dall''ammoniaca libera. Nonostante l''aumento dei VFA, il pH ha mostrato una sostanziale stabilità in cui si può notare che è rimasto sugli stessi livelli antecedenti il blocco delle operazioni di carico, ad eccezione della finestra di tempo ( giorni 93-105) in cui è stato applicato un carico organico di circa 6kgTVS/m 3 rd (Figura 44) Figura 44: Profilo temprale del pH durante il RUN 3 (metanogenesi). 0 1000 2000 3000 4000 5000 6000 7000 8000 60 75 90 105 120 135 150 VF A (m gCOD/l) Tempo (giorni) vfa
A.Propionico
RUN 2 STOP RUN3 6,0 6,5 7,0 7,5 8,0 8,5 9,0 60 75 90 105 120 135 150 pH Tempo (giorni) RUN 2 STOP RUN 3 90 Figura 45: Profilo temporale dell''alcalinità durante il RUN 3(metanogenesi) La stabilità del pH era dovuta alla potere tamponante esercitata dall''alcalinità totale raggiunta nel sistema (Figura 45), la quale, assieme all''alcalinità parziale, ha registrato anch''essa una sostanziale costanza. Un contributo alla capacità tamponante del sistema era sicuramente dato dai Sali ammoniacali disciolti nel mezzo di reazione, dovuto alle alte concentrazioni di ammoniaca raggiunta nei due reattori. Come si può notare nella Figura 46 la concentrazione di azoto ammoniacale in entrambi i reattori ha avuto un profilo crescente ad eccezione delle prime fasi del RUN 3 (giorni 93-105) in cui il blocco del flusso di ricircolo ha comportato una sua riduzione velocità per via dell''effetto della diluizione. Figura 46: Profilo temporale dell''azoto ammoniacale: dark fermentation (destra) e metanogenesi
(sinistra) Con il ripristino delle condizioni d''esercizio previste la concentrazione di ammoniaca è cominciata a risalire sia nel reattore della dark fermentation che nel reattore della metanogenesi con una velocità media di 27mg/Ld e 15mg/Ld rispettivamente. Da qui si evince che il flusso di ricircolo ha un ruolo determinate nel controllare il processo, non solo per l''effetto tampone che esercita in entrambi i reattori ma soprattutto per il possibile effetto inibitorio che l''ammoniaca libera esercita 0 2000 4000 6000 8000 10000 12000 60 75 90 105 120 135 150 Alc ali n ità ( m gCaC O 3/l Tempo (giorni) parziale totale RUN 2 RUN 3 0 300 600 900 1200 1500 1800 2100 2400 2700 3000 0 15 30 45 60 75 90 105 120 135 150 N -NH4+ ( m g/l ) Tempo (giorni) RUN 1 RUN2 RUN3 0 300 600 900 1200 1500 1800 2100 2400 2700 3000 0 15 30 45 60 75 90 105 120 135 150 m g/L Tempo (giorni) N-NH4+ NH3 RUN 1 RUN 2 RUN 3 91 sopra determinati livelli critici. Da qui deriva la necessità di studiare la stabilità del processo a lungo termine e indagare l''effetto della variazione della quantità di flusso di ricircolo in testa al processo. Tale aspetto è stato approfondito nella seconda fase della sperimentazione (RUN 4). Quindi dopo circa 10 giorni dall''inizio del RUN 3, sono stati ripristinati sia il carico organico (~18kgTVS/m 3 rd) che il ricircolo previsti nel piano di lavoro. Facendo riferimento a queste condizioni operative nella tabella seguente vengono riportati i valori dei parametri monitorati nel RUN 3 mediati negli ultimi 15 giorni di esercizio. Tabella 22: valori medi riscontrati nelle CSS del RUN 3 Dark Fermentation Metanogenesi Parametro u.m. Media ± ds Media ± ds TS g/L 57±5 24±7 TVS g/L 46±10 15±4 TVS,TS % 80±10 63±1 tCOD g/L 44±5 17±2 TKN g/L 1.8±0.05 0.8±0.02 PTOT g/L 0.37±0.3 0.2±0.5 pH - 6.1±0.2 8.2±0.1 N-NH4 + mg/l 2175 1875 N-NH4 + mg/Ld 27 15 VFA mgCOD/L 10884±2562 2360±1307 Alcalinità Totale pH 4 mgCaCO3/L - 4225±421 Alcalinità Parziale pH 6 mgCaCO3/L - 7745±411 RESE DI PRODUZIONE GPR m 3/m3d 2±0.6 3±0.7 H2 % (V/V) 18±6 - CH4 % (V/V) 14±8 67±3 CO2 % (V/V) 68±5 33±3 SHP m 3/kgTVS 0.02±0.01 - SGP m 3/kgTVS 0.11±0.03 0.58±0.13 Dall''analisi della Tabella 24 in primo luogo si evince una maggiore variabilità di alcuni parametri rispetto ai RUN precedenti . Questo aspetto potrebbe si potrebbe collegare al fatto che il RUN 3 è stato caratterizzato da condizioni operative non del tutto stabili per via dei tentativi effettuati (alti carichi e sospensione del ricircolo) per inibire l''attività di metanogenesi nel reattore della dark 92 fermentation. Questo aspetto è molto importante se lo si guarda in un''ottica di passaggio in piena scala del processo, in quanto indica le tempistiche di riacquisizione di una nuova condizioni di equilibrio a seguito di possibili problemi, quale ad esempio la sospensione dell''alimentazione. Il blocco delle operazioni di carico, seguito dall''applicazione di un OLR maggiore di 21kgTVS/m3 rd in assenza di ricircolo e la successiva riduzione a 18kgTVS/m 3d con il ripristino del ricircolo, hanno sicuramente rappresentato una condizione di grande stress per la flora microbica presente nei due reattori. Inoltre vi è da dire che la termofila porta alla selezione di consorzi microbici dotati di una minore diversificazione rispetto al regime termico mesofilo, ampiamente diffuso negli impianti industriali. La minore diversificazione della biomassa microbica comporta una limitata capacità di rispondere a stress dovuti a variazioni repentine delle condizioni operative, dilatandone i tempi di riassetto verso nuove condizioni di equilibrio. Tenendo quindi presente le elevate deviazioni standard, il reattore della dark fermentation ha fatto registrare un incremento della velocità media di produzione di gas rispetto al RUN 2 (+63%). Nelle condizioni di pseudo stazionarietà la GPR media del reattore fermentativo era di 2m 3/m3 rd. Nonostante una maggiore produzione di gas, la produzione specifica di idrogeno si è attestata su un valore medio pari a quello precedente (0.02m 3H 2/kgTVS), fatto attribuibile essenzialmente ad un minor contenuto della percentuale di H2 nel gas prodotto (18% V/V) nel quale era presente anche una percentuale media di CH4 del 14%. La ridotta attività delle idrogenasi potrebbe essere legata allo shift che il pH ha subito nel RUN 3 dove ha fatto registrare un valore medio di 6.1, e che non si è riusciti a ridurlo nonostante l''alta concentrazione di VFA ottenuta (> 10 gCOD/L). Per quanto riguarda il reattore della metanogenesi la produzione specifica di biogas nelle condizioni di pseudo stazionarietà è stata di 0.58m 3/kgTVS con un contenuto medio di metano pari al 67% (V/V). La riduzione della produzione specifica di biogas rispetto ai RUN 1 e 2 è coinciso con un incremento della concentrazione media di VFA (2360mgCOD/l) probabilmente dovuto all''effetto inibitorio che l''ammoniaca libera (NH 3) ha esercitato sulla flora microbica metanogena. La concentrazione di azoto ammoniacale nelle condizioni di pseudo stazionarietà è variata nel range 1800-1950 mg/L con una velocità media di accumulo inferiore rispetto al RUN precedente. Ciò sta ad indicare la ridotta attività biologica per via dell''effetto inibitorio che l''ammoniaca libera ha esercitato una volta raggiunte determinate concentrazioni (622mg/L) Nella Tabella 23 sono riportati i bilanci di massa del RUN 3 93 Tabella 23: bilanci di massa del RUN 3 PARAMETRO ENTRATA USCITA ABBATTIMENTO BILANCIO g/d g/d % % TS 4480 4352 61 -3 TVS 3680 3691 71 - PTOT 12.1 11.8 - -2 NTOT 145 161 - +11 La concentrazione di solidi totali nel RUN 3 era di 5.7% e 2.4 % rispettivamente per il reattore della dark fermentation e la successiva fase di metanogenesi. La percentuale di abbatimento dei solidi totali è stata ancora una volta superiore 60% ma leggermente inferiore rispetto alle altre condizioni operative testate. La concentrazione di azoto organico presente nei due reattori era minore del 2% mentre nell''effluente finale il 69% dell''azoto totale era nella forma solubile. La prima parte della sperimentazione relativa alla produzione di bio-hythane ha visto l''impiego di diverse condizioni operative in funzione del carico organico applicato. Nella Tabella 24seguente vengono riportate le rese ottenute nel reattore della dark fermentation e della metanogenesi in funzione del carico organico medio applicato, mentre nella Figura 47 vi è riportata la produzione specifica di idrogeno in funzione degli OLRs effettivo applicato. Tabella 24: Rese specifiche di gas in funzione dell''OLR medio. Dark Fermentation Metanogenesi OLR (kgVS/m 3) SGP (m 3/kgVS) H2 % OLR (kgVS/m 3) SGP (m 3/kgVS) CH4 % RUN1 16.1±1.4 0.13±0.04 35±7 4.2±0.52 0.68±0.07 64±2 RUN2 21.1±0.4 0.06±0.006 34±6 5.6±0.15 0.63±0.12 65±2 RUN3 18.4±1.31 0.11±0.03 18±6 5.1±0.2 0.58±0.13 67±3 94 Figura 47:Andamento della produzione specifica di idrogeno in funzione del carico organico Come si può notare dalla tabella le massime rese specifiche di gas sia nel reattore fermentativo che in quello di metanogenesi sono state ottenute nelle condizioni di carico relative al RUN 1, ossia 16kgTVS/m 3 rd e 4.2kgTVS/m 3 rd rispettivamente. La tendenza del reattore della dark fermentation è stata quella che all''aumentare del carico è corrisposta una riduzione delle rese specifiche in termini di H2. In particolare nel passaggio da un OLR medio di 16kgTVS/m 3 rd (RUN1) a 21kgTVS/m 3 rd (RUN2) si è registrata una diminuzione della portata di gas in uscita dal reattore, mantenendo invariata la distribuzione di idrogeno molecolare e biossido di carbonio in termini di concentrazione (V/V). Wang et al. (2009) ha dimostrato che aumentando il carico, composti come ad esempio l''acido lattico portano ad una parziale inibizione del metabolismo legato alla produzione di H 2. Quindi la riduzione delle rese fatta registrare nel passaggio dal RUN 1 al RUN2 potrebbe essere correlata direttamente alla variazione del carico per via di un accumulo di prodotti su livelli di tossicità per la biomassa idrogenogenica. Effetto inibente che si è continuato a manifestare nel reattore nel passaggio al RUN 3 (OLR:18kgTVS/m 3 rd) , almeno nella fase in cui non è stato raggiunta una condizione di pseudo-stazionarietà. Variazioni delle condizioni operative comporta l''accumulo di diversi prodotto di fermentazione (Oyanedel et al., 2012). Inoltre la riduzione della percentuale di idrogeno fatta registrare nel RUN 3 è dovuta in parte sia allo shift che il pH ha subito nel reattore della dark fermentation (Figura 48) che allo sviluppo di microrganismi idrogenotrofi all''interno del reattore a seguito del blocco delle operazioni di carico. 0,00 0,01 0,02 0,03 0,04 0,05 0,06 0,07 0,08 12 13 14 15 16 17 18 19 20 21 22 23 24 25 SH P ( m3 H 2/kg T VS) OLR (kgTVS/m3rd) 95 Figura 48: correlazione tra pH e produzione di idrogeno (dark fermentation) L''aumento del pH nel reattore della dark fermentation è dovuto al graduale incremento del potere tamponante che ha esercitato l''alcalinità generata nel secondo reattore di metanogenesi. La Figura 49 la correllazione tra il pH del reattore fermentativo e l''alcalinità della seconda fase di metanogenesi. Figura 49: correlazione tra alcalinità totale (metanogenesi) e pH (dark fermentation). Come si può notare dalla figura l''intervallo di alcalinità totale da 5 a 7 gCaCO 3/L è stato quello in cui il pH ha fatto registrare valori ottimali per la produzione di idrogeno. Valori di alcalinità totale maggiori a 7 gCaCO3/L hanno comportato una forza tamponante tale da spostare il pH su livelli non ideali per l''azione delle idrogenasi. L''amento dell''alcalinità della forza tampone è stata correlata con la concentrazione di N-NH 4 + (Figura 50) 0 10 20 30 40 50 60 4,00 4,50 5,00 5,50 6,00 6,50 7,00 H2 (% V/V) pH 0 2000 4000 6000 8000 10000 4,0 4,5 5,0 5,5 6,0 6,5 7,0 A lc al n it à ( m gC aC O 3/ l) pH 96 Figura 50: correlazione tra amoniaca e alcalinità (metaogenesi) Dalla figura si può notare come esiste una diretta correlazione tra la concentrazione di azoto solubile dal quale a sua volta dipende la presenza di sali ammoniacali, i quali come è noto vanno ad esercitare parte dell''effetto tamponante nel buffer di reazione. Quindi è particolarmente evidente che l''ammoniaca gioca un ruolo chiave sugli equilibri di processo. Di fatto l''applicazione continua del ricircolo consente da una parte un recupero di nutrienti e alcalinità, ma dall''altra, a causa degli alti valori assunti, può rappresentare un elemento limitante per l''eccessiva forza tampone esercitata sul pH, spostando questo su valori non ottimali per l''attività delle idrogenasi. Inoltre l''eccessivo accumulo di ammoniaca libera può portare a fenomeni di inibizione del processo di biogassificazione. Nela Tabella 25 sono riportati i bilancio totale del gas prodotto nei due reattori Tabella 25: Composizione del biohythane Idrogenogenesi Metanogenesi GP H2 CH4 CO2 GPRtot SGPtot m 3H 2/d m 3CO 2/d m 3CH 4/d m 3CO 2/d m 3gas/d % % % m 3gas/m3d m 3/kgVS RUN 1 media 0,168 0,285 1,337 0,722 2,512 6,7 53,2 40,1 2,61 0,78 ds 0,041 0,070 0,134 0,072 0,317 - - - 0,33 0,098 RUN 2 media 0,083 0,161 1,665 0,882 2,791 3,0 59,7 37,4 2,90 0,66 ds 0,012 0,023 0,286 0,151 0,472 - - - 0,49 0,11 RUN 3 media 0,070 0,273 1,396 0,667 2,463 2,75 59,60 37,68 2,57 0,67 ds 0,034 0,093 0,277 0,186 0,543 1,18 4,26 3,8 0,57 0,15 2000 3000 4000 5000 6000 7000 8000 9000 10000 0 500 1000 1500 2000 2500 3000 A lc a li n it à ( m g C a C O 3 /l) N-NH4+ (mg/l) 97 Come si può notare la migliore di composizione del biohythane ottenuta nel corso di questa sperimentazione è quella del RUN 1 in cui sono state raggiunte punte del 7.8% di idrogeno, con una produzione specifica di gas media di 0.78m 3/kgTVS. Durante il RUN 2 e il RUN 3 la percentuale di idrogeno non ha mai superato il 5% della composizione totale di gas, limite oltre il quale si hanno i vantaggi dell''impiego del biohythane come combustibile (Porpatham et al., 2007; Rakopoulos et al. 2009, Reith et al. 2003). Dalla prima fase della presente sperimentazione volta a definire una condizione ottimale in termini di carico organico applicato è emerso che le migliori rese sono state ottenute nel RUN1 , quindi con OLR nella prima fase di circa 16 kgTVS/m 3d, con una produzione specifica media di idrogeno di 50 litri per kg di VS alimentato, del tutto paragonabile alle rese ottenute riportate in letteratura in cui però sono stati applicati degli interventi esterni di controllo (controllo del pH esterno, pretrattamenti temici ecc.). Il ricircolo della fase di metanogenesi ha permesso di mantenere il pH della prima fase intorno al valore di 5.5 comportanto tuttavia un accumulo di ammoniaca nel sistema fino al raggiungimento di livelli potenzialmente inibitori sia per la comunità batterica idrogenogenica che per quella metanigena. A partire da questo risultato, in un''ottica di scale-up, nel successivo RUN 4 si è testata la tenuta del processo su un periodo d''esercizio a lungo termine e mantenuto in un''unica condizione operativa prossima a quella del RUN 1, in cui sono state raggiunte le più alte rese in termini di bio-hythane prodotto; in particolare si vuole verificare se i valori dei parametri di processo impostati (HRT, ricircolo etc.) permettono di raggiungere e confermare uno stato stazionario stabile e duraturo e, inoltre, verificare se la modifica della quantità di ricircolo possa stabilizzare il processo all''insorgere di inibizioni dovute in primo luogo all''accumulo di ammoniaca.

98 5.1.4: RUN 4

Nella seconda fase sperimentale è stata valutata la stabilità a lungo termine del processo di produzione combinata di idrogeno e metano mediante un approccio di digestione anaerobica termofila a doppia fase separata. Come riportato nella Tabella 26 , nel primo CSTR adibito alla produzione di idrogeno è stato applicato un carico organico compreso tra i 16 e i 18 kgTVS/m 3 rd e un HRT di 3.3 giorni. Il secondo reattore è stato alimentato con un carico compreso tra i 4-5 kgTVS/m 3 rd ed un HRT di 12.6 giorni. In maniera del tutto analoga alla prima fase sperimentale, il reattore della dark fermentation è stato inoculato con FORSU (66% del volume di lavoro totale) e acqua. Tale reattore è stato alimentato per circa una settimana con carichi organici superiori ai 30kgTVS/m 3 rd in modo tale da mandare il digestore rapidamente in acidogenesi creando quindi condizioni sfavorevoli per lo sviluppo di microrganismi metanogeni. Il carico organico del reattore adibito per la metanogenesi è stato gradualmente incrementato fino ad applicare dopo circa 20 giorni l''OLR previsto dal piano operativo (4-5kgTVS/m3 rd). Nella tabella seguente sono riportate le condizioni operative specifiche del RUN 4. Tabella 26: condizioni operative nel RUN 4 RUN 4 Giorni OLR (dark fermentation) Qr/Qt A 0-90 16-18 kgTVS/m 3 rd 0.5 B 90-172 16-18 kgTVS/m 3 rd 0.25 C 173- 345 16-18 kgTVS/m 3 rd variabile ( 0.0- 0.5) NOTE 179-195 L''alimentazione è stata bloccata ( manutenzione linea di pretrattamento della
FORSU) 230-240 L''alimentazione è stata bloccata ( manutenzione linea di pretrattamento della
FORSU) 240-245 Sovraccarico del reattore della dark fermentation (OLR >60kgTVS/m 3 rd)
Le operazioni relative al RUN 4 si sono protratte per un periodo complessivo di 345 giorni e sono state caratterizzate da variazioni delle condizioni di esercizio che sono state adottate a seguito di evidenze sperimentali che verranno descritte qui di seguito. Il carico organico del reattore della dark fermentation è stato mantenuto nel range 16- 18kgTVS/m 3 rd per l''intero periodo sperimentale fatta eccezione nei giorni 240-245 in cui sono stati applicati carichi organici maggiori di 60 kgTVS/m 3 rd con lo scopo di inibire l''attività dei microrganismi metanogeni sviluppatisi all''interno del reattore (vedere successivamente) . Per via dell''eccessivo accumulo di azoto ammoniacale, intorno al 90° giorno la portata del flusso di ricircolo è stata dimezzata (RUN 4B) rispetto alla condizione di partenza (RUN4 A) in cui erano state applicate le stesse identiche condizioni operative del RUN 1. Al fine di simulare un sistema di 99 controllo automatizzato del flusso di ricircolo da giorno 173 in poi (RUN 4C) il rapporto tra la portata del ricircolo, Qr, e la portata totale, Qt, è stato modificato al fine di mantenere la concentrazione di ammoniaca su livelli inferiori al limite di inibizione del processo di biogassificazione. Le ragioni della variazione del rapporto Qr/Qt risiedono nel fatto che la concentrazione di ammoniaca intorno al 90° giorno aveva raggiunto dei livelli potenzialmente inibenti per il processo di produzione di biogas nel reattore di metanogenesi (Figura 51). Figura 51: profilo temporale dell''ammoniaca durante il RUN 4 Infatti dalla figura 51 risulta che la concentrazione di azoto ammoniacale aveva raggiunto concentrazioni superiori a 2500mg/L, a cui corrispondeva una concentrazione di ammoniaca libera superiore al livello critico di 700mg/L. La strategia di intervento ha previsto il dimezzamento del flusso di ricircolo passando da un rapporto Qr/Qt di 0.5 a 0.25. La variazione del flusso di ricircolo ha consentito di ridurre in pochi giorni il contenuto di azoto ammoniacale in entrambi i reattori. In modo del tutto analogo a quanto si era verificato nella prima fase sperimentale, l''effetto inibitorio dell''ammoniaca si è manifestato attraverso un accumulo di acidi grassi volatili nel reattore di metanogenesi (Figura 52) 0 500 1000 1500 2000 2500 3000 3500 0 30 60 90 120 150 180 210 240 270 300 330 360 Az ot o am m on iacale (m g/L ) Tempo (Giorni) N-NH4+ (metanogenesi)
NH3 (metanogenesi)
N-NH4+ (Dark Fermentation)
RUN 4A RUN 4B RUN 4C 100 Figura 52: profilo temporale dei VFA nel RUN 4 (metanogenesi)
L''incremento dei VFA era dovuto essenzialmente alla presenza di acido propionico, il quale intorno al novantesimo giorno rappresentava il 32% del contenuto totale di acidi grassi volatili (9.5gCOD/L). In corrispondenza della massima concentrazione di VFA registrata, la somma degli acidi caproico (1825mgCOD/L) , butirrico (1818 mgCOD/L) e acetico (1204 mgCOD/L) corrispondeva a più della metà del contenuto totale di VFA. In concomitanza alla variazione del rapporto Qr/Qt per circa una settimana è stato ridotto anche il carico organico nel reattore di metanogenesi al fine di evitare un ulteriore accumulo di acidi grassi volatili. Come si può notare dalla figura 52 la concentrazione di VFA ha subito una netta riduzione, restando su valori inferiori di 2000mgCOD/L per l''intera durata del RUN 4B. Durante il RUN 4 A, il progressivo incremento dell'' azoto ammoniacale ammoniaca ha comportato a sua volta un aumento dell''alcalinità totale nel reattore di metanogenesi (Figura 53) Figura 53: Profilo temporale dell''alcalinità durante il RUN 4 Con l''instaurarsi di fenomeni di squilibrio della catena trofica anaerobica manifestatisi attraverso l''accumulo di acidi grassi volatili (Figura 52), si è assistito ad un aumento della differenza tra i valori di alcalinità totale e parziale (Figura 53). Come c''era da aspettarsi nel RUN 4B si è assistito 0 2000 4000 6000 8000 10000 12000 14000 16000 0 30 60 90 120 150 180 210 240 270 300 330 360 A lc alin ità ( m gC aC O3/l) Tempo (giorni) Alcalinità Totale Alcalinità Parziale RUN 4A RUN 4B RUN 4C 101 ad una riduzione del potere tamponante senza far registrare particolari variazioni del pH all''interno dei due reattori (figura 54) Figura 54:Profilo temporale del pH durante il RUN 4 Nella fatti specie il reattore della dark fermentation ha subito solo ad una lieve riduzione del pH passando da un valore medio di 5.7 (RUN 4A ) a valori intorno a 5.2 (RUN 4B). Solo in corrispondenza dell''ultima settimana del RUN 4B (giorni 166-172) si è assistito ad un ulteriore abbassamento del pH sino a valori inferiori al 5. A tali livelli di pH dalla letteratura risulta che l''evoluzione di idrogeno molecolare è sfavorita a vantaggio di un metabolismo microbico indirizzato verso la produzione composti organici meno ridotti, quali ad esempio acido lattico e alcoli. In corrispondenza dei giorni 166-172, quando il pH della dark fermentation aveva raggiunto valori inferiori al 5, si è verificato sia un crollo della concentrazione di ammoniaca all''interno dei due reattori (Figura 51), che un'' ulteriore riduzione dell''alcalinità parziale e totale nel reattore della metanogenesi (Figura 53) con conseguente riduzione del suo pH (Figura 54) Per tanto al fine di ristabilire le condizioni di equilibrio del RUN 4A prima dell''inibizione, da giorno 172 il rapporto di ricircolo Qr/Qt è stato nuovamente aumentato. Quindi la strategia adottata per l''intera durata del RUN 4C è stata quella di simulare un sistema di controllo automatico agente sul flusso di ricircolo basato sulla valutazione giornaliera dei parametri di stabilità dei due reattori. Come si può notare dalla Figura 51 ciò ha permesso di controllare il livello di azoto ammoniacale il quale non ha mai superato la concentrazione di 1.5g/L evitando quindi cosi raggiugere livelli potenzialmente inibitori, come dimostrato dalla bassa concentrazione di VFA (< 2gCOD/L) fatta registrare nel reattore di metanogenesi (Figura 52) Conseguenza diretta del controllo della concentrazione di ammoniaca nei due reattori è stata il mantenimento della capacità tamponante su valori grosso modo costanti. Inoltre non sono stati evidenziati particolari variazioni del rapporto tra alcalinità totale e parziale (Figura 53) indice di un buon bilanciamento della catena trofica anaerobica. 4 5 6 7 8 9 10 0 30 60 90 120 150 180 210 240 270 300 330 360 pH Tempo (giorni) Metanogenesi Dark Fermentation RUN 4A RUN 4B RUN 4C 102 Con riferimento specifico alle rese del processo, la produzione specifica di biogas nel reattore di metanogenesi ha fatto registrare valori medi di 0.55 e 0.46 m 3/kgTVS rispettivamente nelle condizioni di pseudo stazionarietà del RUN 4B (giorni 122-172) e RUN 4C (giorni 249-345). Tali rese sono state raggiunte a seguito di una netta riduzione avuta quando l''ammoniaca si trovava su valori decisamente superiori al limite di inibizione . (A) (B) Figura 55:Produzione specifica (A) e composizione del biogas (B) nel reattore di metanogenesi
(RUN4)
In corrispondenza della fine del RUN4A e l''inizio del RUN 4B le rese del processo hanno fatto registrare un graduale decremento della percentuale di metano nel biogas prodotto. I livelli minimi di metano e di SGP sono stati rispettivamente del 43% (V/V) e 0.03m 3kgTVS, indicando quindi una completa inibizione del processo di metanogenesi. A seguito della variazione del rapporto Qr/Qt che come abbiamo visto ha comportato una riduzione del contenuto di azoto ammoniacale su livelli del tutto di sicurezza, si è assistito sia ad un aumento della produzione di biogas che un incremento dl contenuto di metano. Per quanto riguarda il reattore della dark fermentation, in corrispondenza del 90° giorno si è manifestata una lieve flessione delle quantità di gas generato, come evidenziato nella Figura 56 in cui si sono riportate la produzione specifica e la velocità di produzione di gas. (A) (B) Figura 56:produzione specifica (A) e la velocità di produzione di gas (B) nel reattore della
dark fermentation (RUN4)
La produzione di gas ha raggiunto una condizione di pseudo stazionarietà dopo circa 30 giorni di esercizio, corrispondenti a 2HRT dell''intero processo. L''SGP ha assunto valori compresi tra 0.1-0- 3m 3/kgTVS mentre le velocità di produzione sono state nel range tra 2 e 5m3/m3 rd. Come già 0,00 0,25 0,50 0,75 1,00 0 30 60 90 120 150 180 210 240 270 300 330 360 S G P (m 3 / k gT VS ) Tempo (giorni) RUN 4A RUN 4B RUN 4C 0 25 50 75 100 0 30 60 90 120 150 180 210 240 270 300 330 360 Com p os ii on e B iog as (% ) Tempo (giorni) RUN 4A RUN 4B RUN 4C 0,00 0,10 0,20 0,30 0,40 0,50 0 30 60 90 120 150 180 210 240 270 300 330 360 S G P (m 3 /k gTVS ) Tempo (giorni) RUN 4A RUN 4B RUN 4 C 0 1 2 3 4 5 6 0 30 60 90 120 150 180 210 240 270 300 330 360 G P R (m 3 /m 3 / rd) Tempo (giorni) RUN 4A RUN 4B RUN 4C 103 descritto nella prima fase della sperimentazione, l''alta variabilità dei valori è da associare all''applicazione di bassi tempi di residenza (3.3 giorni), che a causa del blocco delle operazioni di carico effettuato durante il fine settimana, non consentono di raggiungere delle condizioni i piena stabilità. Confrontando le velocità di produzione di gas ottenute nel RUN4 (> 2m 3/m3 rd) rispetto a quelle medie fatte registrare durante il RUN 1 (1.22m 3/m3rd) si evince un netto incremento delle cinetiche e della quantità di gas prodotto nell''ultimo periodo sperimentale. Tale aspetto può essere ricondotto essenzialmente a due fattori: - Al minor stato di ossidazione della FORSU impiegata nel RUN 4 che, come abbiamo visto nel capitolo 4, risultava avere un rapporto medio COD/TS di 0.96, quindi superiore allo 0.75 misurato nel primo periodo sperimentale. Un minor stato di ossidazione equivale ad una maggiore biodegradabilità del substrato. - Alla presenza nel reattore fermentativo di un''attività di metanogenesi residua che si va a sommare a quella dei produttori di idrogeno. Dal 60° giorno in poi si assistito alla presenza di metano del reattore della dark fermentation. A seguito del blocco delle operazioni di carico dovuto ad interventi di manutenzione sulla linea di pretrattamento della FORSU, l''attività dei microrganismi metanogeni è divenuta più consistente facendo registrare una concentrazione media di metano di circa il 16% (Figura 57), con punte superiori al 20% intorno al 270° giorno. Figura 57: composizione del gas nel reattore della dark fermentation Per tanto la scelta operativa è stata quella di sovraccaricare il reattore della dark fermentation per una settimana alla ripresa delle operazioni di alimentazione (giorno 240). Nonostante ciò l''attività di metanogenesi si è continuata a manifestare. Quindi si è passati a ridurre fino ad annullare il flusso di ricircolo. Seppur subendo in una riduzione l''attività dei microrganismi metanogeni non è 0 10 20 30 40 50 60 70 0 30 60 90 120 150 180 210 240 270 300 330 360 Com p osizion e gas (% ) Tempo (giorni) H2 CH4 Sovraccarico RUN 4A RUN 4B RUN 4C 104 mai cessata completamente probabilmente per una loro acclimatazione alle estreme condizioni operative adottate nel reattore della dark fermentation. Al fine di valutare qualitativamente le differenze delle classi di microrganismi presenti nei due reattori, durante il RUN 4 sono state condotte due diverse caratterizzazioni microbiologiche relative a momenti sperimentali differenti (RUN 4 A e RUN 4 C). Nella Figura 58: profilo delle bande ottenuto mediante PCR-DGGE. Dark Fermentation (F1) e Metanogensi (F2) 58 sono riportati i risultati relativi ad una prima caratterizzazione microbiologica effettuata durante il RUN 4A, quindi nel periodo in cui il reattore della Dark Fermentation produceva essenzialmente H2 e CO2 e il reattore fermentativo aveva ancora dato segnali di instabilità biologica. 105 Figura 58: profilo delle bande ottenuto mediante PCR-DGGE. Dark Fermentation (F1) e Metanogensi (F2)
Tabella 27: sequenziamento delle principali bande ritrovate nel RUN4 A. Dark Fermentation (F1) e Metanogensi (F2) 106 La popolazione batterica presente nei due reattori sono molto differente: infatti sia le bande principali che le bande più deboli sono diverse nei due profili. Dai risultati relativi al sequenziamento delle bande più intense ritrovate (A-B per il reattore della dark fermentation e C-D per il reattore di metanogenesi), la popolazione microbica della dark fermentation è composta prevalentemente dal Phylum Firmicutes e in particolare dalla Famiglia Lactobacillaceae. In particolare la banda A ha mostrato il 99% di similarità con il Type Strain Lactobacillus hamsteri DSM 5661, microrganismo ritrovato anche in altri fermentatori termofili con produzione di idrogeno, alimentati da scarti ricchi in amido (Wang et al., 2010). La popolazione microbica del reattore di metanogenesi è composta prevalentemente dal Phylum Thermotogae. Infatti la banda principale, C, ha mostrato il 99% di similarità con Defluviitoga tunisiensis SulfLac1, della famiglia delle Thermotogaceae, appartenenti al Phylum Thermotogae, anche questo ritrovato comunemente in digestori anaerobici (Rivière et al., 2009) in quanto il Phylum Thermotogae è composto da microrganismi termofili in grado di degradare ed utilizzare carboidrati complessi come xylani e cellulosa (Cardinali-Rezende et al., 2009). La banda D invece ha mostrato il 97% di similarità con il Type Strain Clostridium sporosphaeroides apartenente alla famiglia Clostridiaceae del Phylum Firmicutes, ed il 100% di similarità con altri appartenenti alla stessa famiglia, ma non coltivati (Lee et al. 2010). Anche il genere Clostridium è un tipico microrganismo presente nei digestori anaerobici. I risultati ottenuti sono del tutto comparabili con quelli ottenuti da Luo et al., 2011, che mostrava nel reattore della dark fermentation la predominanza del Phylum Firmicutes, mentre nel reattore di metanogenesi era stato evidenziata la presenza di vari Phylum in associazione con Firmicutes, tra cui come nel presente caso di studio, Thermotogae. Nel RUN4C a seguito del blocco delle operazioni di carico si è assistito ad un aumento della percentule di metano nel gas prodotto dalla dark fermentation, indicando quindi la presenza di microrganismi metanigeni. A conferma di ciò la caratterizzazione microbiologica effettuata mediante tecnica FISH ha confermato la presenza di metanosarcina (Figura 59) Figura 59: Analisi molecolare FISH effettuata nel reattore della dark fermentation: biomassa
microbica completa (sinistra); Methanosarcina (destra).
107 Le tabelle 28 e 29 riportano rispettivamente i valori medi dei vari parametri monitorati nei due reattori e i bilanci di massa facendo riferimento al periodo temporale compreso tra i giorni 270-345 (CSS del RUN4C) Tabella 28: valori medi registati nelle CSS del RUN 4C. Dark Fermentation Metanogenesi Parametro u.m. Media ± ds Media ± ds TS g/L 51±11 31±4 TVS g/L 42±10 19±8 TVS,TS % 81±3 62±5 tCOD g/L 33±3 17±1 TKN g/L 1.3±0.3 1.2±0.2 PTOT g/L 0.33±0.1 0.31±0.1 pH - 5.3±0.2 8.2±0.1 N-NH4 + mg/l 745±282 1115±56 NH3 mg/L - 416±90 VFA mgCOD/L 13171±5100 528±393 Alcalinità Totale pH 4 mgCaCO3/L - 5437±471 Alcalinità Parziale pH 6 mgCaCO3/L - 3602±392 RESE DI PRODUZIONE GPR m 3/m3d 3.47±0.76 2.4±0.3 H2 % 28±9 - CH4 % 15±5 64±5 CO2 % 51±5 34±5 SHP l/kgTVS 50±20 - SGP m 3/kgTVS 0.18±0.04 0.46±0.1

Tabella 29: Bilanci di massa del RUN 4 C. PARAMETRO ENTRATA USCITA ABBATTIMENTO BILANCIO g/d g/d % % TS 4664 4249 60 - 9 TVS 3840 3542 69 - 8 PTOT 19.58 18.6 - - 5 NTOT 144 137 - - 5
Dalla tabella 28 risulta che la concentrazione di solidi totali in uscita dai reattori si è attestata su valori medi del 5% ( TVS 81% dei TS) e 3% ( TVS 62% dei TS) rispettivamente per il reattore fermentativo e della metanogensi. Le percentuali di abbattimento dei solidi è stata del 60%. Il 108 rapporto COD/TS del flusso in uscita dal sistema è stato di 0.54, quindi un alto grado di ossidazione. La concentrazione di azoto organico e fosforo erano inferiori all''2% in entrambi i reattori. La simulazione di un sistema di controllo sul del flusso di ricircolo ha consentito di mantenere su livelli abbastanza costante la concentrazione di N-NH4 + e di conseguenza anche quella dell''alcalinità. I valori medi di azoto ammoniacale negli effluenti dei due reattori sono stati di circa 0.7 e 1g/L rispettivamente per i rettore della dark fermentation e di metanogenesi. L''alcalinità totale del flusso di ricircolo si è mantenuta su livelli di sicurezza assumendo un valore medio superiore ai 5gCaCO3/L. Dall''analisi dei bilanci di massa è risultato che circa il 90% dell''azoto totale in uscita dal sistema era sotto forma di azoto ammoniacale, ad indicando quindi un''elevata biodegradabilità della matrice trattata. Passando alle rese del processo si può notare che nonostante la presenza residua di metano (15% V/V del gas prodotto) in uscita dal reattore fermentativo i valori di SHP ottenuti (50l/kgTVS) sono del tutto paragonabili a quelli ottenuti durante il RUN 1, ossia nelle condizioni operative in cui erano state registrate le massime rese specifiche. Quello che risulta dal confronto sempre con il RUN 1 è una riduzione significativa della produzione specifica di biogas fatta registrare dal reattore di metanogenesi (0.46m 3/kgTVS). Nella Figura 60 vi è riportata la composizione del gas totale prodotto durante l''intera durata del RUN 4. Figura 60: composizione del gas totale prodotto durante il RUN 4. Come si può notare la composizione del gas totale prodotto dai due reattori ha avuto un andamento di sostanziale costanza, ad eccezione ovviamente nel periodo di start up ed in prossimità di quando 0 15 30 45 60 75 90 0 30 60 90 120 150 180 210 240 270 300 330 360 Com p os izio n e b io h yth an e (% ) Tempo (giorni) CH4 H2 CO2 5% RUN 4A RUN 4B RUN 4C 109 sono state cambiate le condizioni d''esercizio. Il maggior grado di stabilità si è ottenuto nel RUN 4 C nel periodo in cui l''alimentazione è stata continua ed è stato controllato il flusso di ricircolo. Facendo riferimento al periodo in cui sono state raggiunte le condizioni di pseudo stazionarietà raggiunte nel RUN 4C e in cui sono state calcolate i valori medi della Tabella 30, qui di seguito vengono riportati i valori medi del gas totale prodotto. Tabella 30: bilancio del gas totale prodotto nei due reattori durante il RUN 4C. Dark Fermentation Parametro media DS max Min H2 (m 3H 2/d) 0.21 0.05 0.31 0.05 CH4 (m 3CH 4/d) 0.13 0.05 0.22 0.04 CO2 (m 3CO 2d) 0.37 0.04 0.44 0.28 Metanogenesi CH4 (m 3CH 4/d) 1.17 0.19 1.57 0.79 CO2 (m 3CO 2d) 0.61 0.12 0.85 0.41 Bio-Hythane H2 (%) 8 2 12 3 CH4 (%) 53 3 61 47 CO2 (%) 38 3 44 29 SGP (m 3/kgTVS) 0.65 0.10 0.80 0.46 GPR (m 3/m3rd) 2.59 0.32 3.12 2.09 Come si può notare dalla tabella 30, nelle condizioni di pseudo stazionarietà del RUN 4C, quindi nel momento in cui è stato simulato un sistema di controllo automatico del processo, la produzione media specifica del gas totale prodotto era di 0.65m 3/kgTVS con una velocità di produzione pari a circa 2.6m 3/m3 rd. In tale periodo la composizione media del gas è rientrata nel range tipico del biohythane, facendo registrare percentuali medie di H2, CH4 ( derivante della somma del metano prodotto sia nel primo che nel secondo reattore) e CO2 rispettivamente del 8%, 53% e 38%. Considerando il potere calorifico inferiore del bio-hythane (5849Kcal/kg) e un rendimento del 40% di un motore di cogenerazione, la produzione specifica di energia elettrica risulta in circa 570kwh/tonnellata di rifiuto pretrattato . Tale valore potrebbe essere paragonato con l''energia elettrica specifica consumata dalla filiera di pretrattamento del rifiuto installata nel WWTP di Treviso, che risulta in 20-40kwh per tonnellata di rifiuto tal quale. 110 A giudicare dalla rese di ottenute e dalla loro stabilità nelle condizioni di esercizio testate, la produzione di bio-hythane mediante un approccio di digestione anaerobica della FORSU a doppia fase separata può essere considerata un processo robusto e maturo da consentire il trasferimento in scala reale. Prima di godere della piena applicabilità è necessario però effettuare un ultimo passaggio, ossia quello di un''automatizzazione dello step di controllo dell''azoto ammoniacale nell''effluente liquido della fase di metanogenesi, che come abbiamo visto è risultato un parametro determinante per la tenuta dell''intero processo. Lo schema proposto è quello mostrato in Figura 61 in cui a valle della separazione solido/liquido è prevista l''installazione di un sistema di sonde in grado di generare un segnale on line tale da controllare un''unità di rimozione dell''azoto ammoniacale, che può essere rappresentato per esempio da un evaporatore. Figura 61: Schema di processo proposto per l''implementazione in piena scala Allo stato attuale non esiste una sistema on line economico e affidabile in grado di dare delle informazioni dirette sulla concentrazione di ammoniaca all''interno di matrici come gli effluenti della digestione anaerobica. Un''alternativa a quella segnali diretti potrebbe quella essere quella dell''installazione di un sistema di sonde in grado di acquisire segnali indiretti che opportunamente elaborati dovrebbero dare delle informazioni sulla concentrazione di ammoniaca nel refluo (Spagni et al., 2001; Provolo et al. 2007) Diversi autori hanno dimostrato che la conducibilità potrebbe essere un segnale indiretto e robusto in grado di dare informazioni sulla concentrazione di nutrienti nei liquami. Per tanto nella fase sperimentale relativa alla valutazione della stabilità a lungo termine del processo di produzione di bio-hythane è stata misurata la conducibilità negli effluenti dei due 111 reattori. Il limite dell''utilizzo di un sistema basato sulla conducibilità per la determinazione dell''azoto ammoniacale consiste nel fatto che poiché essa da informazioni sulla quantità totale di ioni disciolti nel mezzo, il suo andamento dipende da numerosi fattori. Non è possibile quindi correlare direttamente la variazione della concentrazione di ammoniaca ad un variazione del parametro conducibilità. Quello che risulta dai dati acquisiti nel corso di questa sperimentazione fittando i dati di conducibilità con quelli dell'' ammoniaca è quanto rappresentato nelle figura seguente: Figura 62: Conducibilità in funzione dell''ammonica. Dark fermentation (A) e Metanogenesi
(B).
In prima istanza si può notare una certa correlazione tra i due parametri sia nel reattore fermentativo che in quello di metanogenesi . In un determinato range di concentrazione ad una variazione dell''ammoniaca corrisponde una risposta di tipo lineare da parte della conducibilità elettrica, ma essendo una misura aspecifica, la variazione osservata potrebbe non essere una conseguenza diretta della fluttuazione della concentrazione di ammoniaca. Qui di seguito sono elencati i parametri che in qualche modo sembrano influenzare l''alcalinità: - VFA è stato visto che si assiste ad un loro incremento quando l''ammoniaca raggiunge un livello critico (Figura 63). Figura 63: VFA Vs Conducibilità 0 5 10 15 20 25 0 500 1000 1500 2000 2500 3000 3500 4000 Cond u cib il ità (m S /cm ) Metanogenesi: N-NH 4 + (mg/L) B 0 5 10 15 20 25 30 0 500 1000 1500 2000 2500 3000 3500 4000 Cond u cib il ità (m S /cm ) Dark Fermentation : N-NH4+ (mg/L) A 0 5 10 15 20 25 0 2000 4000 6000 8000 10000 Cond u cib il ità (m S /cm ) VFA (mgCOD/L) 112 - Con l''aumento della concentrazione di ammoniaca si assiste ad un incremento della l''alcalinità totale. Ne consegue che all''aumentare dell''alcalinità aumenta la conducibilità. (Figura 64). Figura 64: conducibilità VS alcalinità totale - L''accumulo di VFA porta ad un aumento tra la differenza tra l''alcalinità totale e parziale. Quindi all''aumentare del delta dei valori di alcalinità misurati a pH 4 e pH 6 si assiste ad un aumento della conducibilità (Figura 65) Figura 65: conducibilità Vs differenza tra alcalinità totale e parziale Un sistema di controllo dell''ammoniaca basato sulla determinazione diretta della conducibilità dovrebbe elaborare una risposta derivante da un modello matematico costruito su informazioni derivate da più vari variabili, dalle quali però bisogna escludere quelle meno significative e ridondanti. Informazioni di questo tipo potrebbe essere data da un approccio multivariato, tipicamente utilizzato nell''analisi dei dati ambientali. Poiché con i mezzi attuali l''alcalinità è un parametro che non può essere misurato on line , si è deciso di escluderlo come set di dati in ingresso per l''elaborazione di una regressione lineare multipla la quale dovrebbe essere in grado di restituire 0 5 10 15 20 25 0 2000 4000 6000 8000 10000 12000 14000 C ond uci bil it à (m S/c m ) Alcalinità Tot 0 5 10 15 20 25 0 1000 2000 3000 4000 5000 6000 7000 Cond u cib il ità /m S /cm ) Delta Alcalinità 113 un''equazione ( output) in cui la variabile dipendente Y ( nel nostro caso l''ammoniaca) è definita da una serie di variabili indipendenti o predittori che si suppongano abbiamo effetto su Y. Allo stato attuale è stato elaborato un modello preliminare ma poiché è in corso di validazione i dati non verranno riportati. Come già anticipato il modello dovrebbe essere implementato in un controller in grado di elaborare un segnale rivolto ad un''unità di rimozione dell''azoto ammoniacale, che può essere ad esempio ad esempio un evapo-concentratore . Per tanto sul flusso liquido di ricircolo sono stati condotti dei test preliminari mediante un evaporatore commerciale al fine di avere un''idea generale sulle cinetiche di rimozione dell''azoto ammoniacale. L''effluente concentrato dell''evaporatore è stato impiagato per testare la capacità tamponante residua su un reattore CSTR in scala di laboratorio mantenuto nelle stesse identiche condizioni del reattore pilota della dark fermentation. Il periodo di rifermento nel quale è stato stoccata la matrice è quello relativo agli ultimo 30 giorni di esercizio quando la concentrazione media di azoto ammoniacale era di circa 1g/L. Nella Figura 66 è rappresentata la curva tipica di rimozione dell''azoto in cui sono riportati i valori medi di tre distinte prove di evaporazione. Figura 66: test di rimozione dell''azoto ammoniacale mediante evaporazione Come si può notare dopo circa 4 ore di trattamento era stato rimosso l''80% del volume totale di partenza a cui è corrisposto in termini di flussi di massa l''89% dell''azoto ammoniacale presente nel refluo. La velocità di rimozione è stata di 12.5gNamm/h. Nella Tabella 31sono riportate le caratteristiche dei flussi in ingresso e in uscita dall''unità di evaporazione. 0 10 20 30 40 50 60 70 80 90 100 0 30 60 90 120 150 180 210 240 Rim oz ion e (% ) Tempo (minuti) Azoto rimosso
Volume rimosso a fine prova
114 Tabella 31: caratteristiche dei flussi in ingresso e in uscita dall''evaporatore dopo 4 ore di
trattamento evaporativo.
TEST 1 Parametro UM Influente Effluente Tempo minuti 0 230 N-NH4 + mg/L 922 229 Alcalinità parziale mgCaCO3/L 1963 1071 Alcalinità totale mgCaCO3/L 5355 3867 pH - 7.4 7.4 Conducibilità mS/cm 10.93 9.94 Nonostante le alte rese di rimozione dell''azoto raggiunte dopo circa 4 ore di trattamento, l''effluente dell''evaporatore ha mantenuto più del 70% dell''alcalinità totale iniziale, senza subire particolari variazioni del pH. Al termine della prova si è assistito alla riduzione di circa un punto della conducibilità elettrica. In un'ulteriore prova (Test 2) condotta nelle stesse identiche condizioni d''esercizio ma dalla durata complessiva di un''ora (Tabella 32) si può notare come la perdita di alcalinità totale è stata di circa il 20%, con una riduzione del 25% del volume iniziale. Tabella 32:Caratteristiche dei flussi in ingresso e in uscita dopo 1 ora di trattamento
evaporativo.
TEST 2 Parametro UM Influente Effluente Tempo minuti 0 60 N-NH4 + mg/L 1300 1084 Alcalinità parziale mgCaCO3/L 2979 2016 Alcalinità totale mgCaCO3/L 5448 4394 pH - 8.4 8.2 Conducibilità mS/cm 10.56 8.86 L''effluente dopo 1 ora di trattamento è stato impiagato come flusso di ricircolo nei test su scala di laboratorio (Figura 67) 115 Figura 67: profilo temporale del pH e della produzione di idrogeno del reattore fermentativo
su scala pilota.

I primi 35 giorni relative alle operazioni del reattore fermentativo sul scala pilota, sono stati caratterizzati da tre diversi rapporti Qr/Qt. Nei primi 15 giorni di esercizio (Qr/Qt= 0.25) il pH si è mantenuto sotto il valore 5 e non vi è stata alcuna produzione di idrogeno. Dal momento in cui il rapporto Qr/Qt è stato aumentato, si è assistito ad un incremento del pH a cui è corrisposto un incremento della percentuale di idrogeno nel gas prodotto. Al temine del trentesimo giorno il rapporto Qr/Qt è stato nuovamente ridotto comportando nello stesso tempo una riduzione del pH. Questo aspetto conferma come il flusso di ricircolo a seguito del trattamento evaporativo ha mantenuto la sua capacità tampone ed è quindi in grado di regolare l''intero processo di produzione di H2. 0 20 40 60 80 0 1 2 3 4 5 6 7 8 0 5 10 15 20 25 30 35 40 45 H2 (% ) pH Tempo (giorni) pH H2 Qr/Qt=0.25 Qr/Qt= 0.5 Qr/Qt=0.30 116 5.2 Ottimizzazione dei processi di co-digestione anaerobica di
effluenti d''allevamento, energy crops e sottoprodotti agroalimentari.
5.2.1 Digestione anaerobica di soli effluenti d''allevamento di origine bovina
Per l''ottimizzazione dei processi di co-digestione anaerobica di substrati tipici dell''industria agro- alimentare sono stati impiegati in parallelo 4 reattori CSTR. Ciascun reattore è stato alimentato giornalmente nelle condizioni operative riportate nella tabella seguente. Tabella 33: Condizioni operative Reattore (CSTR) T (°C) HRT (d) OLR (kgVS/m 3 rd)* R1 37 30 4-5 R2 37 30 2-3 R3 55 60 2-3 R4 55 30 4-5 RUN 1 EA (100%) RUN 2 EA(50%) + EC (50%) RUN 3 EA (50%)+ EC (50%)+AW(25%) EA: effluenti d''allevamento (letame + liquame) ; EC: energy crops (insilato di mais) AW: sottoprodotti vegetali. Le percentuali sono riferite al carico organico espresso in VS. Per favorire l''acclimatazione dei microrganismi nuovi regime termici senza subire lo stress del carico, le operazioni di alimentazione sono state anticipate da una fase (18 giorni) in cui i reattori sono stati mantenuti alle temperature d''esercizio previste dal piano operativo senza essere alimentati. Quindi a partire dal diciottesimo giorno i reattori sono stati alimentati quotidianamente con solo effluente d'' allevamento bovino con un rapporto di massa tra i substrati entranti (liquame/letame) pari a 1.5:1 Come verrà descritto in modo dettagliato successivamente, poiché è stata evidenziata una difficoltà di alcuni reattori di raggiungere una condizione di stazionarietà, la prima fase sperimentale relativa all''utilizzo dei soli reflui zootecnici (RUN 1) si è protratta per circa 180 giorni, rispetto ai 120 previsti. Giorno 180 le operazioni di carico sono state sospese in tutti i per circa due settimane per poi riprendere con la seconda fase sperimentale ( co-digestione effluenti d''allevamento e energy 117 crops) che è stata portata avanti fino a giorno 270, momento in cui si è partiti con l''ultima fase ( codigestione effluenti d''allevamento, energy crops e sottoprodotti agroalimentari), che ha avuto la durata di altri 90 giorni. Nella Figura 68 sono riportato i profili temporali del pH dei 4 reattori relativi alla fase start-up e RUN 1. (A) (B) Figura 68: profilo temporale del pH durante il trattamento di effluenti bovini. Come si può notare dalla figura, nella prima fase sperimentale non si è assistito a particolari differenze tra gli andamenti del parametro pH il quale ha mostrato una sostanziale stabilità nel range 8-9 indipendentemente dalle condizioni operative adottate. Tuttavia il pH data la sua natura di tipo logaritmica non è parametro che riesce a dare indicazioni sullo stato transiente di un sistema. In ogni caso per quanto in prima istanza possano non risultare particolari differenze tra i vari reattori, dalla situazione osservata nella Figura 68 si evince una situazione più critica per i reattori termofili, in quanto la concentrazione di ammoniaca libera, parametro essenziale per la tenuta del processo soprattutto nel trattamento di effluenti d''allevamento, dipende dalla temperatura e dal pH. Quindi a parità di pH, a maggiori temperature corrisponde una più alta concentrazione di ammoniaca libera ( vedi successivamente). La stabilità del pH su valori non ottimali ma comunque di assoluta sicurezza presuppone un'' alta capacità del sistema di tamponare l''eventuale presenza di sostanze di natura acida. Il potere tampone all''interno dei digestori è possibile quantificarlo mediante l'' alcalinità totale espressa in carbonati di calcio equivalenti (Figura 69). 7 8 9 10 0 30 60 90 120 150 180 pH Tempo (giorni) R1 R2 7 8 9 10 0 30 60 90 120 150 180 pH Tempo (giorni) R3 R4 118 Figura 69: profilo temporale dell''alcalinità totale e parziale durante le fasi di start-up e RUN 1 In questo caso il livello di informazione è maggiore rispetto a quello fornito dal pH in quanto dall''osservazione del profilo temporale della differenza tra il parametro misurato a pH 6 (alcalinità parziale) e pH 4 ( alcalinità totale) è possibile denotare eventuali squilibri nella catena trofica anaerobica. Nella fase di avviamento si possono notare degli andamenti relativamente costanti, e in termini assoluti tutti i reattori risultano marcatamente tamponati: valori di alcalinità totale dell''ordine di 15000 mg/l sono da considerarsi di assoluta sicurezza, anche per processi ad alto carico come quelli in oggetto (R1 ed R4), dove è più alta il rischio di accumulo di intermedi metabolici di natura acida. L''alto grado di capacità tamponante deriva dall''utilizzo del liquame che, oltre a servire come mezzo diluente, grazie all''alto contenuto di nutrienti incrementa l''effetto buffer per via della formazione di sali ammoniacali. Assieme all''alcalinità l''altro parametro che da maggiori indicazioni circa il comportamento del processo in fase di transiente sono i VFA (Figura 70). Figura 70: profilo temporale dei VFA durante le fasi di start-up e RUN 1 0 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 Alcal in ità (mgCaCO 3/ l) tempo (giorni) parziale totale R1 0 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 Alc ali n ità ( m gCaC O3/ l) Tempo (giorni) Parziale totale R2 0 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 Alc ali n ità ( m cCaC O3/ l) Tempo (giorni) Parziale Totale R3 0 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 Alc ali n ità ( m gCaC O3/ l) Tempo (giorni) Parziale Totale R4 0 3000 6000 9000 12000 15000 18000 0 30 60 90 120 150 180 VF A (m gCOD/L ) Tempo (giorni) R1 R4 START UP RUN 1 0 3000 6000 9000 12000 15000 18000 0 30 60 90 120 150 180 VF A (m gCOD/L ) Tempo (giorni) R2 R3 START UP RUN 1 119 In particolare, facendo riferimento ai reattori ad alto carico il reattore mesofilo R1 mostra un primo periodo (fino a 60 giorni) caratterizzato dal classico pattern di una condizione di messa a regime. Gli acidi grassi volatili scendono in concentrazione da un valore iniziale di circa 9000 mg/l a concentrazioni di poche centinaia. A causa di problemi tecnici dovute a condizioni di carico non completamente costanti intorno al settantesimo giorno, la concentrazione di VFA nel reattore R1 ha subito un improvviso incremento. Tuttavia tale situazione è stata completamente recuperata nel giro di qualche settimana mantenendo costanti le condizioni operative e la concentrazione di VFA si è mantenuta su livelli del tutto di sicurezza per l''intera durata del RUN 1. Il reattore termofilo R4 , che opera nelle stesse condizioni di R1 in termini di OLR e HRT, mostra una diminuzione lineare del parametro VFA , senza tuttavia raggiungere valori molto bassi di concentrazione. L''alta contenuto di VFA e la bassa percentuale di metano ( vedi successivamente) fatti registrare intorno a giorno 30 hanno portato alla decisione di ridurre il carico organico fino a livelli inferiori ai 2kgTVS/m 3 rd per poi aumentarlo gradualmente. Come si può notare nonostante l''azione intrapresa il reattore ha mostrato una certa sofferenza a portare termine le ultime fasi della catena trofica. Le concentrazioni medie di acido acetico (C2) e acido propionico (C3) nel periodo compreso tra i giorni 90-120 ricoprivano in media una frazione del 14% e 33% rispettivamente. La differenza della distribuzione tra i due acidi in favore del propionico suggerisce la difficoltà della flora batterica termofila ad adattarsi alle nuove condizioni di esercizio. Tale difficoltà è stata riscontrata anche nel reattore termofilo a basso carico (R3) il quale, dopo aver avuto un periodo iniziale in cui i VFA hanno avuto un profilo decrescente, non è mai riuscito a raggiungere condizioni di sicurezza facendo registrare un contenuto medio superiore ai 6000mgCOD/L. La distribuzione media di concentrazione anche in questo caso era a favore dell''acido propionico (31%). Per quanto riguarda i reattori a basso carico, il mesofilo R2 ha indicato una situazione del tutto classica, ottenendo una diminuzione progressiva della concentrazione in acidi fino ai valori di regime. R2 può essere considerato a tutti gli effetti il reattore ''controllo'' del sistema, probabilmente perché caratterizzato dalle condizioni di esercizio più blande e simili a quelle dell''impianto da cui è stato prelevato l''inoculo. Le difficoltà maggiori della flora microbica termofila ad adattarsi alle nuove condizioni operative rispetto ai microrganismi mesofili risultano particolarmente evidenti se si guarda agli andamenti della composizione del biogas dai quali emergono elementi particolarmente interessanti in fase transiente, perché immediatamente correlabili allo stato di salute del processo. 120 Figura 71: profilo temporale della composizione del biogas durante le fasi di start-up e RUN
1
Come si può notare l''unico reattore che sin dall''inizio ha mostrato delle condizioni di sostanziale stabilità è stato R2, dove sia nella fase di start up che per l''intera durata del RUN 1 la concentrazione di CH4 non è mai scesa sotto il 50%. Il reattore mesofilo ad alto carico R1 ha evidenziato un carattere più instabile. Infatti nella fase transiente si può notare un iniziale incremento della concentrazione di CH4 sino a raggiungere delle punte del 75% per poi decrescere e trovare un certo grado di stabilità solo dopo circa 120 giorni (4HRT). Molto più critica è stata invece la situazione osservata nei reattori termofili (R3 e R4). La concentrazione di CH4 nel reattore a termofilo a basso carico (R3) è incrementata sin quando sono stati ridotti i carichi applicati. Dal momento in cui l''OLR è stato nuovamente aumentato (da giorno 60) si può notare come il sistema ha evidenziato una variazione delle concentrazioni di CO2 e CH4 verso una nuova condizione di equilibrio. Quindi facendo riferimento alla composizione di biogas, il reattore R3 intorno a 75 giorno ha raggiunto una concentrazione media di metano intorno al 50% , mantenendo comunque un certo gradi di criticità nel corso del RUN 1 in quanto la concentrazione di CO2 superava tal volta quella del metano. La condizione di instabilità è stata particolarmente evidente per il reattore termofilo ad alto carico R4 dove si può notare che nell''arco dei primi 180 giorni vi è stata una continua variabilità della composizione del biogas. C''è da ricordare che a causa delle criticità evidenziate l''OLR non è mai stato particolarmente costante, quindi le variazione della composizione del biogas possono essere associate alle fluttuazioni di carico. In prossimità del giorno 160 la concentrazione di anidride carbonica segnava un continuo incremento che in concomitanza con progressivo accumulo di VFA ha portato alla decisione di bloccare le operazioni 0 25 50 75 100 0 30 60 90 120 150 180 Com p osizion e b iogas (% ) Tempo (giorni) CH4 CO2 R1 0 25 50 75 100 0 30 60 90 120 150 180 Com posizion e B iogas (%) Tempo (giorni) CH4 CO2 R2 0 25 50 75 100 0 30 60 90 120 150 180 Com p osizion e B iogas (% ) Tempo (giorni) CH4 CO2 R3 0 25 50 75 100 0 30 60 90 120 150 180 Com p osizion e b iogas (% ) Tempo (giorni) CH4 CO2 Altri Gas R4 121 di carico nel reattore R4 (giorno 180). Situazione osservata sul finire del RUN 1 anche nel reattore R3 per via del progressivo incremento della percentuale di CO2 del gas in uscita e dal crollo delle produzione gas come vedremo qui di seguito. Quindi le operazioni di carico sono state bloccate in tutti i reattori al fine di poter continuare ad effettuare nel RUN 2 un confronto parallelo tra le diverse condizioni d''esercizio. Dall''osservazione del profilo temporale della produzione specifica di biogas nei reattori mesofili il periodo di stazionarietà è stato identificato a partire da giorno 100. Figura 72: produzione specifica di biogas durante le fasi di start-up e RUN 1 La produzione specifica media dei due reattori ha subito un costante incremento fino ad assestarsi intorno ai valori medi ( circa 0,2 m 3/ kgTVS). In particolare il reattore mesofilo a basso carico R2 ha fatto registrare un valore medio di 0.23m 3/kgTVS corrispondente al 28% in più rispetto ad R1 (0.18m 3/kgTVS). Nella tabella 36 sono riassunti i valori medi dei parametri caratterizzanti gli effluenti dei reattori mesofili nel periodo prendendo come riferimento gli ultimi 60 giorni d''esercizio corrispondente a circa 2 HRT per il reattore R1 e un HRT completo per il reattore R2. 0 0,1 0,2 0,3 0,4 0 30 60 90 120 150 180 S G P (m 3/k gTVS ) Tempo (giorni) R1 0,00 0,10 0,20 0,30 0,40 0 30 60 90 120 150 180 S G P (m 3/k gTVS ) Tempo (giorni) R2 122 Tabella 34: valori medi registrati dai reattori mesofili nelle CSS del RUN1 EA 100% Parametro R1 R2 Condizioni operative OLR (kgTVS/m 3 rd) 4.3±0.2 2.2±0.1 HRT (giorni) 30 60 T (°C) 37±1 37±1 P. di stabilità pH 8.6±0.3 8.6±0.2 VFA (mgCOD/L) 846± 605±280 N-NH4 + (mg/L) 3513±301 3886±574 NH3 1043±190 1142±462 Alcal. Tot (CaCO3/L) 14803±2150 14300±2111 Alcal. Par. (CaCO3/L) 10820±1395 10211±1710 P. su secco TS (mg/g) 107±5 99±5 TVS (% TS) 76±4 71±0.5 COD (mgCOD/gTS) 797±29 775±63 TKN (mgN/gTS) 28±4 28±3 P (mgP/gTS) 4.6±1 5±0.5 Rese di Processo GPR (m 3/m3 rd) 0.79±0.07 0.49±0.04 SGP (m 3/kgTVS) 0.18±0.02 0.23±0.02 CH4 (%) 57±3 57±3 CO2 (%) 42±3 42±3 Gli effluenti dei due reattori sono stati caratterizzati da un''elevata capacità tamponante tale da stabilizzare il pH dell''intero sistema intorno al valore medio di 8.6. Valore decisamente elevato per i normali intervalli riscontrati nelle applicazioni normali della digestione anaerobica. Valori superiori a 8 non sono da considerarsi ottimali per il processo di metanogenesi ma comunque di assoluta sicurezza. Un contributo importante al potere tampone deriva sicuramente sia dall''azoto che ha raggiunto valori pressoché costanti e intorno a 3500 mgN/l in R1 e 3900 mgN/l in R2. I tempi di residenza idraulici applicati nel reattore R2 consentono una più lunga esposizione dei substrati all''azione dei microrganismi rispetto al caso del reattore R1 tali da giustificare la differenza tra i due valori. L''analisi dei bilanci di massa ha evidenziato che il 9.8% dell''azoto totale nell''effluente R1 si trovava sotto forma solubile di cui la concentrazione media di NH 3 risultata essere di 1043 mg/l (2.9% dell''N TOT), mentre il reattore R2 ha mostrato un contenuto medio di ammoniaca libera di 1442 mg/l pari al 4.5% dell''azoto totale. La differenza tra l''alcalinità totale e parziale del sistema conferma un accumulo quasi nullo di VFA (< 1gCOD/l). La bassa concentrazione di acido acetico pari a circa il 90% del contenuto totale di VFA indica che è l''attività omoacetogena a dirigere l''intero processo di metanogenesi in entrambi i reattori mesofili 123 (dati non mostrati). Gli effluenti dei due reattori sono stati caratterizzati inoltre da un contenuto di sostanza secca pari al 10%, di cui più del 70% volatile. Per quanto riguarda le rese del processo in termini di biogas prodotto , nella condizione di pseudo- stazionarietà raggiunta, il reattore R1, ha mostrato un valore medio di produzione di biogas di 0.79 m 3/m3rd, decisamente più elevato rispetto ai 0.49 m3/m3 rd fatti registrare da R2. Nello stesso tempo la composizione del biogas si è attestata su un valore medio per entrambi i reattori del 57% CH4, 42.5% CO2 e 0.5% di altri gas. Le basse rese specifiche in biogas (SGP) sono confrontabili con quelle tipiche registrate negli impianti in piena scala per il trattamento di soli reflui zootecnici: ad esempio, dati provenienti da impianti danesi hanno evidenziato produzioni specifiche di circa 0.2 m 3/kgVS sia per liquame che per letame di origine bovina, per quanto caratterizzati da tenore in sostanza secca nettamente differenti, pari al 9% e 16%, rispettivamente. Le scarse rese ottenibili dal trattamento di tali matrici sono essenzialmente dovute al basso contenuto di sostanza secca nei liquami (7-9% per i bovini) unito ad un elevato livello di ossidazione (evidenziato dai bassi tenori di COD della sostanza secca) e ad un''elevata presenza di fibre nel letame. Nonostante le basse rese, i reflui zootecnici rappresentano un substrato ideale per la digestione anaerobica dei rifiuti organici grazie alla presenza di una larga varietà di nutrienti per la crescita batterica. Inoltre l''elevata quantità di acqua presente nel liquame, caratterizzata anche da un''alta alcalinità, consente di diluire l''elevato tenore di secco presente nei residui agroindustriali e di tamponare i valori di pH in caso di accumulo di VFA. Nella Tabella 35 sono riportati i bilanci di massa condotti nei reattori mesofili durante le CSS del RUN 1. Tabella 35:Bilanci di massa nei reattori mesofili (trattamento effluenti d''allevamento) R1 R2 IN (g/d) OUT (kg/d) REM (%) BAL (%) IN (kg/d) OUT (kg/d) REM (%) BAL (%) TS 1130 1050 25 - 7 565 525 30 -7 TVS 930 855 30 - 8 465 414 39 -11 N 52 52 - 0 26 26 - 0 P 4.1 3.9 - - 5 2.05 1.9 - -3 Le percentuali di abbattimento registrate vanno dal 25% dei TS in R1 al 30% in R2 (Tabella 35).La verifica dei bilanci di massa mediati sul periodo ha dato esito positivo: tutti i bilanci si chiudono 124 con errori inferiori alla variabilità media legata a matrici eterogenee, quali i substrati complessi utilizzati in queste prove.
Per quanto riguarda il regime termico, i reattori R3 e R4 hanno manifestato come abbiamo visto un andamento discontinuo per diversi parametri, per via delle variazioni di carico applicate che si sono riversate ovviamente sull''andamento dei parametri di resa. Per avere un''idea dell''influenza che le fluttuazioni dell''OLR hanno avuto sulla produzione di gas, in Figura 73 vi sono riportati i profili temporali della GPR in entrambi i reattori termofili, ricordando che i carichi applicati nel reattore R4 sono sempre stati il doppio del reattore R3. Figura 73: profili temporali della GPR nei reattori termofili durante il RUN 1. Come si può notare a prescindere dai tempi di residenza applicati i due reattori hanno avuto un grado di produzione di gas molto
grado di produzione di gas molto simile nella fase di avviamento. Dopo circa 1 HRT (60giorni) il reattore R3 ha raggiunto un
reattore R3 ha raggiunto un sostanziale grado di stabilità mantenendolo fino al termine del secondo HRT (giorno 120) ,
HRT (giorno 120) , momento in cui è stato aumentato il carico organico. Nel periodo in esame il carico organico applicato è stato
carico organico applicato è stato tra 1- 1.5kgTVS/m
3 rd e la percentuale di metano e anidride carbonica avevano grosso modo la carbonica avevano grosso modo la stessa distribuzione. Facendo riferimento allo stesso periodo il reattore R4 ha fattore
reattore R4 ha fattore registrare un progressivo incremento della GPR. Intorno a giorno 120 il carico organico è stato
carico organico è stato nuovamente aumentato fino a raggiugere le condizioni operative previste dal piano operativo ma come si
piano operativo ma come si può notare entrambi i reattori nel giro di qualche settimana hanno fatto segnalare un crollo della
segnalare un crollo della produzione. Nella
Tabella 36 sono riportati i valori medi dei parametri registrati negli ultimi 60 giorni di esercizio, ricordando che non si possono considerare delle condizioni di stazionarietà, per via della variabilità dell'' OLR applicato che ha caratterizzato il regime termico termofilo nel RUN 1. 0,00 0,25 0,50 0,75 1,00 0 30 60 90 120 150 180 G P R ( m 3/ m 3rd) Tempo (giorni) R4 R3 125 Tabella 36: valori medi registrati dai reattori termofili negli ultimi 60 giorni del RUN1. R3 R4 Paramentri di stabilità pH 8.8±0.2 8.6±0.1 *VFA (mgCOD/L) 5950-9170 3420-11230 N-NH4 + (mg/L) 3340±270 3245±201 NH3 1746±487 1999±208 Alcal. Tot (CaCO3/L) 11103±565 11791±823 Alcal. Par. (CaCO3/L) Parametri su secco TS (mg/g) 75±12 83±7 TVS (% TS) 70±0.7 72±0.73 COD (mgCOD/gTS) 762±91 827±102 TKN (mgN/gTS) 33±3 30±4 P (mgP/gTS) 5.2±1 5.4±1 * Trand variabile. I valori si riferiscono al livello massimo e al minimo riscontrato E' da notare come, a differenza del caso dei reattori operanti in mesofilia, il tenore di ammoniaca libera (NH3) sia in questo caso prossimo a valori di poco inferiori ai 2 gN/L, valore che è in grado di determinare condizioni di inibizione della biomassa metanigena. Poiché il limite di inibizione riportato in letteratura per la termofilia è di circa 700 mg/L, la situazione fatta registrare può essere definita di assoluto stress biologico per la biomassa in esame. Probabilmente risiede in questo fatto la più difficile gestione, riscontrata almeno nelle fasi iniziale, del processo in queste condizioni termiche Va infine evidenziato che l''elevata variabilità riscontrabile dalle deviazioni standard relative ai valori dei solidi totali e volatili in reattore è associabile ai numerosi interventi di variazione del carico organico applicato, condotte attraverso modifica del contenuto in secco del flusso di alimentazione (TS=7,5% per R3 e 8,3% per R4). 126 Nella Tabella 37 sono riportati i valori riscontrati di alcuni parametri chiave negli ultimi giorni di esercizio, dalla valutazione dei quali si è deciso di interrompere le operazioni di carico per poi riprenderle in regime di co-digestione con colture dedicate. Tabella 37: valori riscontrati negli ultimi giorni di esercizio del RUN 1 in termofilia (rese,
composizione biogas e VFA).
Parametro Unità R3 R4 SGP m 3/kgTVS 0.12 0.07 GPR m 3/m3 rd 0.17 0.18 CH4 % 48 43 CO2 % 52 58 VFA mgCOD/L 7925 9011 Acido Acetico % 11 35 Acido Propionico % 44 35 L''alta concentrazione di VFA ( 8-9 gCOD/L) registrata e il basso contenuto di metano (< 50%) erano indice di un'' assoluta disarmonia tra le relazioni sintrofiche dei diversi consorzi microbici anaerobi. Cosa tra l''altro confermata dalle bassissime rese in biogas e dall''alta percentuale di acido propionico rispetto al contenuto totale di VFA. I percorsi metabolici attivati quindi non erano quelli che culminano con la produzione di metano, che in genere vedono una prevalenza di acido acetico e butirrico. Nella figura seguente vi è riportata la distribuzione delle varie forme azotate ( azoto organico e azoto ammoniacale) in ingresso e in uscita dai 4 reattori Figura 74: distribuzione dell''azoto totale nei flussi in entrata e in uscita dai reattori (RUN1). 127 Come si può notare trattamento di soli effluenti d''allevamento comporta già in partenza un elevato contenuto di azoto ammoniacale (41% dell''azoto totale). La scarsa biodegradabilità delle matrici in esame inoltre è testimoniato dal basso grado di ammonificazione ottenuto che ha raggiunto dei livelli intorno al 15% in condizioni mesofile e inferiore al 10% per la termofilia, a conferma delle difficoltà che la flora microbica ha riscontrato nel degradare la sostanza organica a 55°C. 5.2.2 Co-digestione anaerobica di effluenti d''allevamento ed energy crops.
Nella seconda parte sperimentale (RUN2) i quattro reattori sono stati mantenuti nelle stesse identiche condizioni operative del RUN precedente con l''unica differenza che la miscela di partenza era composta sia da effluenti zootecnici che da piantagioni vegetali coltivate esclusivamente a scopo energetico. Le condizioni operative applicate ed i dettagli relativi alla preparazione della miscela sono indicate nella tabella seguente. Tabella 38: Condizioni operative previste nel RUN 2 (reflui zootecnici ed energy crops) Parametro R1 R2 R3 R4 T (°C) 37 37 55 55 HRT (giorni) 30 60 60 30 OLR (kgTVS/m3rd) 4 2 2 4 Liquame/Letame 1.5 1.5 1.5 1.5 Insilato di Mais (kgTVS/m 3 rd) 2 1 1 2 R (Qr/Qt) 0.3 0.3 0.3 0.3 Come si può notare il carico organico complessivo, la temperatura di esercizio e il tempo di residenza idraulico sono identici a quelli applicati per la sola digestione dei soli liquami zootecnici (RUN1). Tale approccio riduce le variabili associate ai comportamenti della flora batterica in relazione ai substrati di partenza consentendo quindi univocamente di attribuire e quantificare eventuali variazioni di rese e/o dei valori dei parametri medi di stabilità alle differenti matrici in ingresso. Poiché le colture energetiche sono caratterizzate da un tenore di sostanza secca superiore a quella degli effluenti d''allevamento, per controllare il contenuto di solidi nella miscela di partenza è stato applicato un ricircolo della fase liquida. Questa approccio inoltre consente di facilitare la messa a regime dei reattori assicurando un veloce sviluppo del potere tamponante. Infatti come si può vedere dalla Figura 75 le prime fasi della RUN2 sono caratterizzate da un incremento 128 dell''alcalinità totale rispetto a quelli registrati durante trattamento di soli effluenti d''allevamento. La ragione di ciò può risiedere nel fatto che l''utilizzo di substrati più biodegradabili comporta a parità di carico un aumento della CO2 disciolta nel mezzo incrementando quindi la concentrazione di carbonati. Figura 75: Profili temporali dell''alcalinità durante il RUN 2 L''aumento di alcalinità è stato registrato in tutti e quattro i rettori con valori medi intorno a 20 gCaCO3/L in mesofilia e 16gCaCO3/L per la termofilia. Valori come questi sono da considerare di assoluta sicurezza in queste condizioni di esercizio circa il rischio di overloading, anche nel caso di trattamento di matrici ad elevata biodegradabilità. Inoltre, si deve notare che il delta tra il parametro misurato a pH 6 e ae pH 4 è costante e di bassa entità, indice che nell''interfase le concentrazioni di acidi in accumulo sono ridotte. La robustezza dei sistemi in termini di potere tamponante è stata confermata dall''andamento del pH (Figura 76), che ha assunto un profilo i sostanziale costanza, ad eccezione un leggero decremento fatto registrare nella fase transiente. Il buon bilanciamento della catena trofica è stato confermato dall''andamento dei VFA (Figura 77) 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 210 240 270 Alc ali nità ( m gCaC O 3/l) tempo (giorni) parziale totale R1 RUN 1 RUN 2 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 210 240 270 A lc alin ità ( m gC aC O3/l) Tempo (giorni) Parziale totale R2 RUN 1 RUN 2 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 210 240 270 Alc ali n ità ( m cCaC O3/ l) Tempo (giorni) Parziale Totale R3 RUN 1 RUN 2 5000 10000 15000 20000 25000 0 30 60 90 120 150 180 210 240 270 Alc ali n ità ( m gCaC O3/ l) Tempo (giorni) Parziale Totale R4 RUN 1 RUN 2 129 Figura 76: profilo temporale del pH nel RUN 2 Figura 77: Profilo temporale dei VFA nel RUN 2 In particolare il reattore mesofilo a basso carico R2 ha continuato ad assumere il comportamento più stabile senza subire alcun cambiamento del profilo assunto nel RUN precedente, nemmeno in fase transiente. Per quanto riguarda il reattore mesofilo ad alto carico R1, invece, una certa influenza sulla stabilità di processo è evidenziabile attraverso l''aumento del valore dei VFA fino a 2000-3000 mg/l. Sebbene del tutto compatibile con queste condizioni di esercizio, il comportamento osservato potrebbe indicare una maggiore sensibilità del processo ad HRT dimezzati e carichi raddoppiati rispetto ad R2 quindi e carichi decisamente più ''pesanti'' rispetto all''altra condizione d''esercizio. Tuttavia, come indicato nei grafici seguenti, il processo si sostiene comunque, e non è escluso che prolungando il mantenimento di queste condizioni per tempi molto più lunghi (dell''ordine di 2-3 HRT completi) si possa comunque giungere ad una condizione di assoluta stabilità. Tale osservazione si può estendere anche alla condizione termica termofila in quanto non si osservano particolari differenze in termini di equilibrio raggiunto tra il basso (R3) e l''alto carico (R4). La sostituzione di metà del carico organico con gli energy crops ha contribuito notevolmente ad armonizzare i rapporti sintrofici tra le classi di microrganismi acidogeni e metanogeni. Le ragioni potrebbero risiedere, come evidenziato in diversi lavori in letteratura, in un bilanciamento del rapporto tra i macronutrienti nel feedstock di partenza. Infatti il trattamento di soli effluenti d''allevamento è caratterizzato da uno sbilanciamento del rapporto C/N dovuti ad un eccesso di azoto, in particolare sottoforma ammoniacale. L''aggiunta di un co-substrato ad alto 7 8 9 10 0 30 60 90 120 150 180 210 240 270 pH Tempo (giorni) R1 R4 RUN 1 RUN 2 7 8 9 10 0 30 60 90 120 150 180 210 240 270 pH Tempo (giorni) R3 R2 RUN 1 RUN 2 0 3000 6000 9000 12000 15000 18000 0 30 60 90 120 150 180 210 240 270 VF A (m gCOD/L ) Tempo (giorni) R1 R4 RUN 1 RUN 2 0 3000 6000 9000 12000 15000 18000 0 30 60 90 120 150 180 210 240 270 VF A (m gCOD/L ) Tempo (giorni) R2 R3 RUN 1 RUN 2 130 contenuto di carbonio, come ad esempio l''insilato di mais, contribuisce a riequilibrare verso rapporti ottimali il parametro C/N. Nella presente sperimentazione non è stata codotta una misura del carbonio totale, ma un''idea di come il rapporto tra i principali nutrienti è variato nel passaggio dal RUN 1 al RUN 2 può essere sicuramente data considerando i parametri COD e azoto totale. Durante il RUN 1 tale rapporto ha assunto un valore medio di 17.5, mentre nel RUN 2 c''è stato un incremento intorno a 28.5. Un''ulteriore fattore che sicuramente ha contribuito ad un corretto svolgimento dei processi metabolici è stato la riduzione del carico azotato. Nella Figura 78 sono riportati i profili del contenuto di azoto ammoniacale e di ammoniaca libera presenti nei 4 reattori. Figura 78: Profilo temporale dell''ammoniaca durante il RUN 2 Come si può notare il regime di co-digestione anaerobica degli effluenti zootecnici con energy crops ha comportato una riduzione de contenuto di azoto ammoniacale in tutti reattori, in modo particolare in quelli mesofili. I valori di fine processo sono comunque elevati, aggirandosi intorno i 2000-3000 mg/l, anche grazie alla modulazione resa possibile attraverso il ricircolo di parte della frazione liquida effluente. Questa indicazione apre la strada ad una logica di controllo molto più interessante rispetto a quella manuale adottata in questa fase di ricerca: infatti, se il parametro chiave nel controllo dei sovraccarichi è il sistema buffer che si instaura in reattore, e a sua volta il controllo del buffer è legato essenzialemente alla concentrazione in ammoniaca, è pensabile, in applicazioni in piena scala, ad un sistema esperto che dosi il flusso di ricircolo in base alle reali necessità di processo, e lo possa fare in tempo reale, ottimizzando così il sistema. Anche per gli andamenti dell''ammoniaca, non si notano particolari differenze tra esercizio a basso ed alto carico, 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 0 30 60 90 120 150 180 210 240 270 m g/L Tempo (giorni) Azoto Ammoniacale Ammoniaca libera R1 RUN 1 RUN2 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 0 30 60 90 120 150 180 210 240 270 m g/l Tempo (giorni) Azoto Ammoniacale Ammoniaca libera R2 RUN 1 RUN 2 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 0 30 60 90 120 150 180 210 240 270 m g/ L Tempo (giorni) NH4+ NH3 RUN 1 RUN2 R3 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 0 30 60 90 120 150 180 210 240 270 N -NH4+ ( m g/l ) Tempo (giorni) NH4+ NH3 R4 RUN 1 RUN 2 131 eccetto una maggiore variabilità nel secondo caso, ma che si mantiene sugli stessi valori delle condizioni a carico basso. Quindi il sistema si può considerare ancora una volta gestibile, anche in queste condizioni di esercizio, con una riduzione dei tempi di residenza del 50 %. Con riferimento particolare al contenuto di ammoniaca libera, parametro dipendente dalla temperatura e pH, si è assistito ad una forte riduzione in modo particolare nei reattori operanti in regime termofilo. Questo ha comportato una condizione meno stressante per la flora microbica anaerobica che nello stesso tempo ha cominciato a incrementare la quantità di biogas prodotto (Figura 79). Figura 79: profilo temporale del grado di produzione di biogas durante il RUN 2 Considerando gli andamenti del grado di produzione di biogas (GPR, m 3/m r 3 d), si può notare innanzitutto una netta differenza in termini quantitativi tra i reattori a basso ( R2 e R3) e ad alto carico (R1 e R4). Infatti la GPR di R1 ed R4 oscilla tra 1-2 m 3/m3 rd rispetto a R2 ed R3 il cui range varia tra 0.5-1 m 3/m3 rd (la variabilità del parametro GPR probabilmente è dovuta a problemi tecnici di alimentazione). Si ricordi infatti che si tratta di substrati molto eterogenei in particolare nel caso del letame bovino che spesso si trovava mescolato a materiale fibroso proveniente dalla lettiere della stalla da cui veniva fatto conferire e quindi talvolta il controllo delle operazioni di carico ed estrazione su quantitativi dell''ordine dei chilogrammi può essere soggetto ad errori. Facendo riferimento al raggiungimento delle condizioni di pseudo stazionarietà i reattori mesofili hanno mostrato dei tempi di adattamento minori rispetto ai reattori termofili. Questo aspetto è stato particolarmente evidente nei reattori con tempi di residenza ridotti (30 giorni): dopo circa un paio di settimane R1 ha fatto registrare delle produzioni nell''ordine dei valori riscontrati alla fine del RUN 2, mentre il tratto di incremento transiente di R4 ha avuto una pendenza meno accentuata. Tuttavia le rese raggiunte da R4 sono state leggermente superiori rispetto ad R1. Stessa considerazione va effettuata confrontando R2 ed R3 in cui anche in questo caso si è notato un vantaggio in termini quantitativi a favore della termofilia (R3). Comunque in linea generale si può affermare che l''utilizzo dell''insilato di mais come substrato di partenza, comporta dei vantaggio non solo in termini di resa rispetto alla sola digestione di effluenti d''allevamento a prescindere dalla condizione 0,0 0,3 0,5 0,8 1,0 1,3 1,5 1,8 2,0 0 30 60 90 120 150 180 210 240 270 G P R (m 3/m 3r d ) Tempo (giorni) R1 R4 RUN 1 RUN 2 0,00 0,25 0,50 0,75 1,00 1,25 1,50 1,75 2,00 0 30 60 90 120 150 180 210 240 270 G P R (m 3 /m 3 rd) Tempo (giorni) R2 R3 RUN 1 RUN 2 132 operativa adottata ma soprattutto , in particolare per la termofilia, comporta ad una maggiore stabilità del processo. Nella Tabella seguente sono riportati i valori medi riscontrati nelle condizioni di pseudo stazionarietà prendendo come riferimento gli ultimi 15 giorni d''esercizio del RUN 2. Tabella 39: valori medi riscontrati nel trattamento di effluenti d''allevamento ed energy crops RUN 2: EA (50%) + EC (50%) R1 R2 R3 R4 Condizioni operative OLR (kgTVS/m 3 rd) 4.2±0.2 2.1±0.1 2.1±0.1 4.2±0.2 HRT (giorni) 30 60 60 60 T (°C) 37±1 37±1 55±1 55±1 P. di stabilità pH 8.2±0.2 8.0±0.1 8.3±0.1 8.3±0.2 VFA (mgCOD/L) 1616±251 403±100 2503±380 2989±210 N-NH4 + (mg/L) 2626±354 2750±114 2900±254 2798±224 NH3 508 448 725 733 Alcal. Tot (CaCO3/L) 20262±1245 21671±958 15353±785 16253±885 Alcal. Par. (CaCO3/L) 13850 15828 9526 10045 P. su secco TS (mg/g) 92±0.4 81±0.2 81±0.2 87±0.2 TVS (% TS) 72±0.1 71±0.2 74±0.2 72±0.1 COD (mgCOD/gTS) 850±112 884±98 868±85 829±85 TKN (mgN/gTS) 14±3 12±2 11±2 12±1 P (mgP/gTS) 5±1 5±1 5±1 5±1 Rese di Processo GPR (m 3/m3 rd) 1.3±0.05 0.74±0.05 0.79±0.05 1.3±0.04 SGP (m 3/kgTVS) 0.32±0.01 0.37±0.01 0.40±0.01 0.41±0.02 CH4 (%) 53±1 56±1 55±1 55±1 CO2 (%) 45±1 43±1 45±1 44±1 La più alte rese specifiche in termini di biogas sono state ottenute dal reattore termofilo ad alto carico (R4: 0.41m 3/kgTVS), il quale ha raggiunto una SGP di circa il 28% superiore a quella del reattore mesoflo R1, che ha lavorato nelle stesse condizioni operative. Per quanto riguarda i reattori a basso carico anche in questo caso la termofilia risulta essere la scelta più idonea (R3: 0.4 133 m 3/kgTVS), la quale ha comportato un incremento dell''8% rispetto alla mesofilia (R2: 0.37m 3/kgTVS). Facendo riferimento alle produzioni specifiche di biogas, complessivamente si può ribadire che in regime di co-digestione di effluenti d''allevamento di origine bovina con insilato di mais, la termofilia consente di ridurre i volumi delle vasche di reazione in quanto non sono state riscontrate particolari differenze tra le SGP ottenute per i diversi HRT testati. Guardando alla capacità tamponante del sistema a parità di regime termico non si riscontrano particolari differenza tra l''alto e il basso carico, con livelli di alcalinità di assoluta sicurezza. Nettamente superiori risultano invece i valori di alcalinità raggiunti discriminando i due regimi termici. Con riferimento specifico all''alcalinità totale nonostante uno scarto di circa 5000mgCaCO3/L tra mesofilia e termofilia, non si registrano differenza tra i valori di pH a prescindere dalla condizione operativa adottata. Passando alla concentrazione di VFA i reattori termofili hanno evidenziato dei livelli superiori a quelli dei reattori mesofili, ma comunque non sufficientemente alti da destare sospetti di un sbilanciamento della catena trofica anaerobica. Aspetto questo confermato se si guarda alle percentuali di CH4 che sono state nel corso di tutto il RUN 2 sempre superiori al 50%. La differenza registrata tra le concentrazioni di VFA nei due regimi termici è tipica se si considerano le costanti di idrolisi riportate in letteratura e confermate nelle prove batch. La concentrazione di solidi totali negli effluenti dei 4 reattori è stata dell''8-9% sul peso totale umido. A parità di condizione termica, dall''analisi di bilanci di massa (Tabella 40) è risultato un abbattimento dei solidi totali e volatili più elevato nei reattori operanti a tempi di residenza dell''ordine dei 60 giorni. 134 Tabella 40: Bilanci di massa nel RUN 2 ( co-digestione effluenti d''allevamento e energy crops). Alto Carico Mesofilo R1 (HRT:30d) Alto Carico Termofilo R4 (HRT:30d) IN (g/d) OUT (g/d) REM (%) BAL (%) IN (g/d) OUT (g/d) REM (%) BAL (%) TS 1130 1090 35 - 3 1130 1110 37 - 2 TVS 990 910 44 - 8 990 910 43 - 8 N 34 31 - -9 34 31 - 12 P 3.8 3.8 - 0 3.8 3.8 - 0 Basso Carico Mesofilo R2 (HRT:60d) Basso Carico Termofilo R3 (HRT:60d) TS 560 520 43 7 550 530 41 - 4 TVS 480 430 52 -11 480 440 50 - 8 N 17 14.8 - 13 17 15 - - 11 P 1.9 1.62 - - 15 1.9 1.62 - - 15 Infine le concentrazioni sia di azoto ammoniacale che dell''azoto organico hanno raggiunto dei livelli molto simili in tutte le condizioni operative. Osservando la distribuzione delle due forme azotate in ingresso e in uscita dai reattori (Figura 80) si può notare un elevato grado di ammonificazione, il quale ha raggiunto livelli superiori al 50%, confermando quindi sia la buona attività biologica della flora batterica che l''elevato grado di biodegradabilità degli energy crops. Figura 80: distribuzione dell''azoto in ingresso e in uscita dai 4 reattori (RUN 2) 135 5.2.3 Co-dogestione di effluenti d''allevamento, energy crops e sottoprodotti agroalimentari. Nell''ultima parte della sperimentazione relativa all''ottimizzazione del processo di co-trattamento di substrati tipici dell''industria agroalimentare si è testata la possibilità di sostituire con sottoprodotti tipici dell''industria agroalimentare il 50% del carico organico applicato nel RUN 2 proveniente dagli energy crops. Quindi l''OLR su base VS nel RUN 3 era composto da: ' 50% effluenti d''allevamento ( liquame/letame con un rapporto in peso umido pari a 1.5:1)
' 25% colture dedicate ( insilato di mais)
' 25% residui agroalimentari vegetali ( patate, cipolle, ecc.) Poiché i substrati venivano conferiti da una vicina azienda agricola il tipo di sottoprodotto impiegato nella sperimentazione è dipeso dalla disponibilità dell''azienda stessa. Tra i vari residui, le patate sono state conferite nel corso dell''intera sperimentazione, quindi, dal punto di vista della composizione chimica si è trattato di un substrato contenente principalmente amidi e carboidrati (composti a catena lunga ma comunque facilmente biodegradabili). La variazione della composizione della miscela di partenza non ha comportato particolari fluttuazioni del pH ( Figura 81) il quale, tranne un leggero decremento fatto registrare nella fase transiente, ha assunto un andamento di assoluta stabilità in tutte le condizioni operative. Figura 81: profilo temporale del pH nel RUN3 La capacità del sistema di stabilizzare in tempi ridotti il parametro pH è dovuta all''effetto del ricircolo il quale era caratterizzato da un elevata alcalinità totale nei 4 reattori (Figura 82). 7 8 9 10 195 210 225 240 255 270 285 300 315 330 345 360 pH Tempo (giorni) R1 R4 RUN 2 RUN 3 7 8 9 10 195 210 225 240 255 270 285 300 315 330 345 360 pH Tempo (giorni) R3 R2 RUN 2 RUN 3 136 Figura 82: Profili temporali dell''alcalinità totale e parziale (RUN 3) Come si può notare, l''utilizzo di una quota di residui agroaliementari in luogo di energy crops non non ha modificato la capacità tamponante del mixed liquor la quale si è mantenuta intorno ai valori di 20 e 15gCaCO3/L rispettivamente per i reattori mesofili e termofili. L''unica variazione osservata è stata un aumento del delta tra i valori misurati a pH 4 e pH 6 nella fase transiente dove si è registrato un leggero aumento della concentrazione di VFA, correlabile con il riadattamento alle nuove condizioni operative (Figura 83). Figura 83: profilo temporale dei VFA (RUN3) Il basso contenuto dei VFA registrato per tutto in RUN 3 ha evidenziato una buona sintrofia tra le differenti classi di microrganismi della flora batterica anaerobica. Quindi nonostante l''elevata biodegradabilità delle matrici non si è assistito ad uno sbilanciamento della catena trofica. Aspetto confermato dall''analisi della composizione del biogas prodotto dai 4 reattori (Figura 84) 5000 10000 15000 20000 25000 195 210 225 240 255 270 285 300 315 330 345 360 Alc ali nità ( m gCaC O 3/l) tempo (giorni) parziale totale RUN 2 RUN 3 5000 10000 15000 20000 25000 195 210 225 240 255 270 285 300 315 330 345 360 Alc ali n ità ( m gCaC O3/ l) Tempo (giorni) Parziale totale R2 RUN 2 RUN 3 5000 10000 15000 20000 25000 195 210 225 240 255 270 285 300 315 330 345 360 Alcali n ità (m cCaCO 3/ l) Tempo (giorni) Parziale Totale R3 RUN 2 RUN 3 5000 10000 15000 20000 25000 195 210 225 240 255 270 285 300 315 330 345 360 Alc ali n ità ( m gCaC O3/ l) Tempo (giorni) Parziale Totale R4 RUN 2 RUN 3 0 3000 6000 9000 12000 15000 18000 195 210 225 240 255 270 285 300 315 330 345 360 VF A (m gCOD/L ) Tempo (giorni) R1 R4 RUN 2 RUN 3 0 3000 6000 9000 12000 15000 18000 195 210 225 240 255 270 285 300 315 330 345 360 VF A (m gCOD/L ) Tempo (giorni) R2 R3 RUN 2 RUN 3 137 Figura 84: profilo temporale della composizione del biogas (RUN 3) Come si può notare nel RUN 3 non si sono verificate particolari variazioni rispetto alla condizione precedente e la percentuale di metano si è mantenuta sempre superiore al 50% tranne che nella fase transiente e in qualche rara occasione in corrispondenza di sovraccarichi dovuti a problemi tecnici. Quindi in generale si può affermare che l''aggiunta di residui vegetali ad elevata biodegradabilità, quali sottoprodotti dell''industria agroalimentare, non modifica il comportamento dei reattori in termini di stabilità del processo rispetto alla condizione precedente dove il co-substrato era rappresentato solo da insilato di mais. Tuttavia facendo riferimento alle rese specifiche in termini di biogas prodotto si può notare che dopo una prima fase di transizione dove si assiste ad una lieve riduzione, più accentuata nei reattori termofili, la quantità di biogas prodotto per kg solidi volatili entranti ha subito un graduale incremento fino a raggiungere una condizione di pseudo stazionarietà (Figura 85). Figura 85: profilo temporale della produzione specifica di biogas (RUN 3) 0 25 50 75 100 195 210 225 240 255 270 285 300 315 330 345 360 Com p osizion e b iogas (% ) Tempo (giorni) CH4 CO2 R1 RUN 2 RUN 3 0 25 50 75 100 195 210 225 240 255 270 285 300 315 330 345 360 Com posizion e B iogas (%) Tempo (giorni) CH4 CO2 R2 RUN 2 RUN 3 0 25 50 75 100 195 210 225 240 255 270 285 300 315 330 345 360 Com p osizion e B iogas (% ) Tempo (giorni) CH4 CO2 R3 RUN 2 RUN 3 0 25 50 75 100 195 210 225 240 255 270 285 300 315 330 345 360 Com p osizion e b iogas (% ) Tempo (giorni) CH4 CO2 R4 RUN 2 RUN 3 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 195 210 225 240 255 270 285 300 315 330 345 360 S G P (m 3/k gTVS ) Tempo (giorni) R1 R4 RUN 2 RUN 3 0,0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 195 210 225 240 255 270 285 300 315 330 345 360 S G P (m 3/k gTVS ) Tempo (giorni) R2 R3 RUN 2 RUN 3 138 Come si può notare non esistono particolari differenze per quanto riguarda la produzione di biogas tra i reattori ad alto e basso carico, confermando ancora una volta la possibilità di poter operare con tempi di residenza dimezzati rispetto allo scenario riscontrabile negli impianti in esercizio , il ché si traduce nel poter ridurre notevolmente le volumetrie dei digestori di nuova progettazione. Elemento degno di nota nel caso si scelga di operare a tempi di residenza ridotti è la necessità di dover verificare la quantità di emissioni prodotte dai digestati e quindi valutare la necessità di installare coperture per le vasche di stoccaggio a valle dei digestori. Nella Tabella 41 vengono riportati i valori medi riscontrati nel regime di co-digestione di effluenti d''allevamento, colture dedicate e sottoprodotti vegetali dell''industria agroalimentari, facendo riferimento agli ultimi 40 giorni di esercizio, periodo in cui le produzioni specifiche hanno raggiunto grosso modo una condizione di stazionarietà in tutti e 4 i reattori. Tabella 41: valori medi evidenziato nel RUN 3 RUN 3: EA (50%) + EC (25%) + AW (25%) R1 R2 R3 R4 Condizioni operative OLR (kgTVS/m 3 rd) 4.2±0.2 2.1±0.1 2.1±0.1 4.2±0.2 HRT (giorni) 30 60 60 60 T (°C) 37±1 37±1 55±1 55±1 P. di stabilità pH 8.3±0.2 8.5±0.1 8.5±0.1 8.5±0.1 VFA (mgCOD/L) 66±115 115±34 172±89 238±114 N-NH4 + (mg/L) 2600±125 2775±241 2100±321 1450±425 NH3 524 806 930 833 Alcal. Tot (CaCO3/L) 21152±924 19800±445 17320±657 18320±774 Alcal. Par. (CaCO3/L) 14775 14962 11880 12305 P. su secco TS (mg/g) 89±0.3 85±0.3 81±0.2 90±0.3 TVS (% TS) 74±0.2 73±0.1 72±0.1 72±0.1 COD (mgCOD/gTS) 743±112 791±170 810±103 730±111 TKN (mgN/gTS) 30±2 29±3 34±3 33±1 P (mgP/gTS) 7±1 6.6±1 6±1 6±1 Rese di Processo GPR (m 3/m3 rd) 2±0.01 0.98±0.01 1.13±0.02 2.17±0.02 SGP (m 3/kgTVS) 0.48±0.01 0.47±0.02 0.54±0.01 0.52±0.01 CH4 (%) 52±1 54±1 53±1 54±1 CO2 (%) 48±1 46±1 47±1 46±1 EA: effluenti d''allevamento (letame+ liquame); EC: energy crops (insilato di mais); AW : sottoprodotti vegetali agroindustriali ( patate, cipolle ecc.) 139 Dal confronto dei valori medi riportati nella Tabella 43 risulta che non ci sono differenze tra le diverse condizioni operative se si guarda ai parametri di stabilità. Infatti, riferendosi ai valori di alcalinità ( > 15000 mgCACO3/L) e di pH (> 8), i reattori risultano largamente tamponati e assolutamente al sicuro nel caso si dovessero verificare condizioni di overloading che potrebbero portare all''accumulo di intermedi metabolici di natura acida. Resta comunque un fattore critico gli alti valori di pH registrati, in corrispondenza dei quali le concentrazioni di ammoniaca libera raggiungono livelli tali da poter inibire le reazioni della catena trofica anaerobica. Si noti che le concentrazioni di NH3 raggiungono valori molto vicini al limite di inibizione per la flora microbica riportato in letteratura (700mg/L). A giudicare dalle basse concentrazioni di VFA (< 500mg/L) e dalla composizione del biogas che ha mostrato una concentrazione media di metano superiore al 50% si delinea un buon bilanciamento tra le diverse fasi della digestione anaerobica, a sottolineare la perfetta sintonia tra le diverse classi di microrganismi. Con riferimento alle rese specifiche ottenute la migliore condizione d''esercizio risulta essere quella adottata nel reattore termofilo a basso carico R3 che ha fatto registrare un SGP media di 0.54 m 3/kgTVS, circa il 15 % in più rispetto al reattore mesofilo mantenuto nelle stesse identiche condizioni operative in termini di OLR e HRT. In ogni caso tutti i rattori hanno registrato un incremento delle rese rispetto alla condizione operativa adottata nel RUN 2, dove era stato instaurato un regime di co-trattamento di soli effluenti zootecnici e colture energetiche. La sostituzione della metà del carico adottato nel RUN 2 proveniente dall''insilato di mais con sottoprodotti agroalimentari di natura vegetale ha portato ad incrementi di resa compresi tra il 25% e il 50%. La concentrazione di solidi totali negli effluenti dei reattori era compresa tra l''8-9% del peso umido tal quale, con una frazione di solidi volatili del 72-74% dei solidi totali. Dall''analisi dei bilanci di massa condotti (Tabella 42), è risultato un abbattimento dei solidi totali intorno al 41-42% per i reattori con tempi di residenza di 30 giorni, mentre quelli con tempi di residenza di 60 giorni hanno fatto registrare abbattimenti del 45-47% . Tali valori rientrano nel range tipico riscontrato in processi di digestione anaerobica monofase (40-50%). 140 Tabella 42: Bilanci di massa del RUN 3 Alto Carico Mesofilo R1 (HRT:30d) Alto Carico Termofilo R4(HRT:30d) IN (g/d) OUT (g/d) REM (%) BAL (%) IN (g/d) OUT (g/d) REM (%) BAL (%) TS 1229 1245 42 +1 1229 1256 41 +2 TVS 982 1060 46 +8 982 1054 47 - 7 N 42 42 - 0 42 36 - -15 P 4.5 4.9 - +8 4.5 4.3 - -5 Basso Carico Mesofilo R2 (HRT:60d) Basso Carico Termofilo R3(HRT:60d) TS 614 596 45 -3 614 606 47 -1.5 TVS 491 504 49 +3 491 515 50 +5 N 21 21 - 0 21 19 - - 8 P 2.2 2.2 - 0 2.2 1.9 - - 14 Con riferimento specifico all''azoto ammoniacale negli effluenti le concentrazioni medie di ammoniaca sono risultate superiori ai 2 g/L per tutti i reattori ad eccezione del reattore termofilo ad alto carico (R4) la cui concentrazione media di N-NH4 + è stata di circa1.5 g/L (Tabella 41). Le ragioni di tale differenza potrebbero risiedere in un errore analitico, come si potrebbe evincere dal fatto che il bilancio effettuato sull''azoto totale nei flussi in entrata e in uscita dal reattore non si chiudono del 15% (Tabella 42). In Figura 86 vi è riportata la distribuzione delle varie forme azotate nei flussi entranti e uscenti dai reattori. Figura 86: distribuzione dell''azoto in entrata e in uscita dai 4 reattori 141 Come si può notare dalla figura 86 in condizioni mesofile il grado di ammonificazione è stato del 33% e 36%, rispettivamente per i reattori R1 e R2; mentre per i termofili i gradi di ammonificazione sono stati del 27% e 19% rispettivamente per R3 e R4. Complessivamente dalle indagini condotte relativamente alla verifica su scala pilota di grossa taglia del processo di digestione anaerobica di matrici di origine zootecnico-agroindustriale è stato possibile stabilire che dal trattamento dei soli effluenti d''allevamento nelle condizioni operative testate risulta che le migliori rese specifiche in termini di biogas sono state raggiunte ad una temperatura di 37°C, con un OLR di circa 2kgTVS/m 3 rd ed un HRT di 60 giorni. In queste condizioni d''esercizio l'' SGP media registrata è stata di 0.23m3/kgTVS, mostrando un 28% in più rispetto al reattore R1 mesofilo alimentato con il doppio del carico e mantenuto a tempi di residenza dell''ordine dei 30 giorni, il quale ha raggiunto delle rese specifiche medie di 0.18kgTVS/m3 rd. Il motivo per cui il reattore R2 ha avuto delle rese maggiori rispetto ad R1 potrebbe risiedere nel fatto che esso è stato mantenuto in condizioni operative molto simili a quelle adottate nell''impianto in piena scala da cui è stato prelevato l''inoculo dei reattori pilota. Nonostante gli alti carichi e i bassi tempi di residenza applicati il reattore mesofilo R1 non ha evidenziato segni di squilibrio della catena trofica, mostrando un''elevata stabilità. Questo indica la possibilità di dimezzare le volumetrie dei nuovi digestori, riducendo quindi sia i costi di investimento ( minori tempi di ritorno di investimento) che l''impatto visivo degli impianti di digestione anaerobica sul territorio. Sempre facendo riferimento alla sola digestione di effluenti d''allevamento il regime termofilo ha denotato una certa instabilità del processo biologico con accumulo di acidi grassi volatili nel reattore e basse rese in biogas. L ''utilizzo di un co-substrato di buona biodegradabilità come l''insilato di mais e sottoprodotti vegetali di origine agroalimentare ha notevolmente migliorato il comportamento del processo, sia sotto il profilo della stabilità che delle rese in tutte le condizioni operative testate. In particolare nel regime termofilo l''aumento della stabilità del processo registrata con l''aggiunta dei co-substrati è associabile ad un maggior bilanciamento nell''apporto di nutrienti. Infatti il trattamento di soli effluenti d''allevamento è caratterizzato da un basso rapporto C/N dovuto ad un eccesso di azoto. L''aggiunta di co-substrati ad alto contenuto di carbonio e a basso contenuto di azoto, soprattutto in forma ammoniacale, ha contribuito ad equilibrare il rapporto C/N. L''effetto stabilizzante sul processo biologico che la riduzione della quota di azoto ammoniacale ha comportato non si è manifestato solo attraverso un miglior bilanciamento del rapporto C/N ma anche direttamente sulla diminuzione dell''effetto inibitorio che l''ammoniaca libera esercita sui microrganismi termofili. Questo aspetto è particolarmente evidente se si osserva la Figura 87 dove 142 sono riportati i dati relativi alla concentrazione di ammoniaca libera e di VFA prendendo come riferimento l''intero periodo di sperimentazione. Figura 87: acidi grassi volatili in funzione dell''ammoniaca libera nei reattori termofili Dalla figura si evince chiaramente che in entrambi i reattori termofili ad alte concentrazioni di NH3 corrispondono valori più elevati di VFA. Tali dati sono perfettamente in linea con quelli riscontrati da Angelidaky and Ahring (1994). Diversi studi hanno dimostrato che il meccanismo inibente dell''ammoniaca si esercita attraverso il blocco delle reazioni che portano alla degradazione dell''acido propionico. Tale effetto si esercita in modo predominante sul metabolismo idrogenotrofo che porta alla formazione di metano a partire da H2 e CO2, mentre in maniera nettamente inferiore si manifesta sul metabolismo che porta alla formazione di metano a partire dall''acido acetico (Wiegant et al., 1986). Diversi autori tra cui Banks et al., 2012 e Vavlin, 2010, hanno dimostrato che in termofilia il metabolismo predominante è quello idrogenotrofo. Inoltre viene confermato ciò il ruolo dell''acido propionico come indicatore tempestivo di una eventuale insorgenza di sbilanciamento nella catena trofica a causa dell''effetto inibitorio esercitato dall''ammoniaca libera (Nienlsen et al., 2007) .
Le migliori rese in regime di co-digestione di effluenti d''allevamento con energy crops sono state ottenute dal reattore termofilo ad alto carico 0.41m 3/kgTVS, circa 28% in più rispetto al reattore mesofilo mantenuto nelle stesse condizioni operative. Anche in questo caso non ci sono state particolari differenze tra i reattori alimentati con un alto e un basso carico. La sostituzione di parte del carico organico derivante dagli energy crops con un sottoprodotti vegetali dell''industria agroalimentare ha comportato un incremento del 25-50% delle rese in termini di produzione specifica a seconda delle condizioni operative adottate. La più alta SGP (0.54m 3/kgTVS) è stata raggiunta dal reattore termofilo alimentato con un carico organico di circa 2 kgTVS/m 3 rd e con un HRT di circa 60 giorni. L''aumento di produzione ottenuta nell''ultimo periodo sperimentale è riconducibile senz''altro al minor contenuto di elementi di natura fibrosa presente nei 0 2000 4000 6000 8000 10000 12000 14000 0 1000 2000 3000 4000 VFA ( m g COD/L ) Free Ammonia (mg/L) R3 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 0 1000 2000 3000 4000 VFA ( m g COD/l) Free Ammonia (mg/l) R4 143 sottoprodotti vegetali testati, come ampiamente dimostrato in letteratura (Lentomaki, 2006), e confermato dai più alti valori sperimentali delle costanti di idrolisi ottenute nelle prove batch (Tabella 16) . Inoltre confrontando le rese specifiche ottenute nei vari periodi sperimentali (RUN 1, RUN 2 e RUN3) con le rispettive massime rese teoriche ottenibili calcolate sulla base dei contributi ponderali dei diversi substrati nelle miscele di partenza adottate (tabella 45), si può notare come nell''ultimo RUN sperimentale ( co-digestione di effluenti d''allevamento, energy crops e sottoprodotti agroalimentari) sono state ottenute delle rese specifiche superiori al 90% del massimo teorico, valori superiori rispetto a quelli ottenuti nel RUN2. Tale aspetto conferma che i sottoprodotti vegetali adottati in questa sperimentazione contengono una quota minore di sostanze lentamente biodegradabili rispetto all''insilato di mais. Tabella 43: produzione specifiche teoriche e ottenute nel trattamento di reflui agroindustriali SGPteorica (m 3/kgTVS) SGPottenuta (m 3/kgTVS) SGPteorica/SGPottenuta (%) RUN 1 R1 0.21 0.18 - 14 R2 0.23 + 9 R3 0.21 - - R4 - - RUN 2 R1 0.46 0.32 - 30 R2 0.37 - 20 R3 0.51 0.40 - 22 R4 0.41 - 20 RUN 3 R1 0.47 0.48 + 2 R2 0.47 0 R3 0.51 0.54 + 6 R4 0.52 + 2 Vi è da sottolineare che l''elevata differenza tra le rese ottenute nelle operazioni in continuo rispetto a quelle teoriche ottenibili nel RUN 2, suggerisce che probabilmente nel secondo periodo sperimentale non erano state ottenute ancora le condizioni di stazionarietà e quindi bisognava ampliare la finestra sperimentale relativa alla co-digestione degli effluenti d''allevamento con energy crops ( per esigenze contrattuali si è dovuti passare alla successiva fase sperimentale). Infine passando alla qualità degli effluenti ottenuti nei diversi periodi sperimentali, con rifermento specifico alla distribuzione delle diverse forme azotate ( azoto organico e azoto ammoniacale) 144 risulta che l''utilizzo dei sottoprodotti porta ad un minor contenuto di azoto ammoniacale in tutte le condizioni operative testate. Questo aspetto risulta di particolare importanza se si considerano i costi specifici dei processi a valle della digestione che prevedono la rimozione dell''azoto. Figura 88: frazione di azoto ammoniacale ottenuto durante il trattamento di reflui
agroindustriali
Dalla Figura 88 risulta ancora una volta che la termofilia è più conveniente rispetto al mesofilia considerando il minor grado di ammonificazione raggiunto nelle condizioni operative testate.









41 54 58 48 49 13 61 68 71 66 17 50 53 44 36 0 10 20 30 40 50 60 70 80 90 100 IN OUT R1 OUT R2 OUT R3 OUT R4 N -NH 4 + / Tota l N itrog en (%) RUN1 RUN 2 RUN 3 145
5.3 Confronto di diversi sistemi di pretrattamento meccanico della
FORSU.

In un ottica di ottimizzazione dei processi di digestione anaerobica della porzione biodegradabile dei rifiuti solidi urbani, sono state confrontate quattro tecnologie di pretrattamento meccanico della FORSU. Le caratteristiche delle linee di pretrattamento e le rispettive tipologia di raccolta di rifiuto effettuate a monte del conferimento sono riassunte in Tabella 44 Tabella 44: Tipologia di pretrattamenti e rispettive strategie di raccolta differenziata. Tecnologia Specifica Tipologia di raccolta Energia Specifica IMPIANTO 1 Idropolpatore Alla fonte + porta a porta Alta IMPIANTO 2 Pressa d''estrusione Porta a porta Bassa IMPIANTO 3 Separazione a umido Cassonetti centralizzati + porta a porta Bassa IMPIANTO 4 Mulino a coltelli Porta a porta Bassa
Come si può notare dalla tabella nonostante le tipologie di raccolta differenziata a monte della linea di pretrattamento fossero molto simili, le tecnologie di preselezione adottate sono differenti e con diverse potenze specifiche installate. In generale gli impianti 2, 3 e 4 sono caratterizzati da consumi energetici ridotti rispetto all''impianto 1. Con riferimento specifico alla modalità di raccolta differenziata, nei 4 casi di studio analizzati si trattava di piani di raccolta di tipo porta a porta puro ad eccezione per gli impianti 1 e 4 dove una quota dei rifiuti conferiti proveniva da sistemi di raccolta alla fonte (Impianto 1), cioè da grosse utenze ( supermarket, hotel, ecc.), e da sistemi di raccolta condotta mediante cassonetti centralizzati (impianto 3). Quindi per gli impianti 1 e 3 era prevedibile un maggior grado di contaminazione. Aspetto questo confermato dall''analisi merceologica condotta sui flussi in ingresso alle unità di pretrattamento (Tabella 45). Tabella 45: analisi merceologica dei rifiuti in ingresso ai pretrattamenti. Classe Merceologica Impianto 1 Impianto 2 Impianto 3 Impianto 4 % WW % DW % WW % DW % WW % DW % WW % DW Frutta e Verdura 35-45 25-35 26-35 13-20 38-46 30-38 22-34 15-20 Rifiuti da cucina* 4-10 4-8 33-50 44-55 13-16 12-19 33-48 43-54 Carte e Cartoni** 10-15 10-15 5-10 9-11 13-18 15-19 3-7 8-12 Plastiche** 10-15 16-20 5-10 9-11 5-10 7-14 6-12 8-11 Inerti** 5-8 10-15 4-7 8-10 6-12 14-19 6-8 7-9 Non classificabile 18-23 18-21 4-6 4-6 10-20 13-25 4-6 4-6 *Materiale putrescibile non vegetale (Es. pasta, dolci, carne ecc.). WW=peso umido. DW= peso secco
** Frazione grigia (carte e cartoni + plastiche + inerti)
146 Dalla tabella 45 si evince una similarità di flussi in esame, con una frazione ad elevata biodegradabilità (frutta e verdura, rifiuti da cucina e parte della categoria non classificabile) che supera sempre il 60% del peso umido totale. La frazione grigia (carta, cartoni, plastiche e inerti) è leggermente più elevata nei rifiuti conferiti negli impianti 1 e 3 rispetto agli altri flussi in esame. Per quanto riguarda la frazione a cui non è stato possibile attribuire una classe merceologica ben definita vi è da dire che si trattava di una componente di piccole dimensioni ed essenzialemte di natura putrescibile alla quale spesso si trovava adesa una quota di materiale inerte sabbioso. Il fatto che gli impianti 1 e 3 avessero una quota di materiale non classificabile superiore rispetto agli altri due ( impianti 2 e 4) delinea una minor efficienza degli approcci di raccolta. Aspetto questo ancora più evidente se si guarda al tenore di solidi volatili che caratterizza la categoria non classificabile nell''Impianto 3, dove la percentuale di TVS rispetto ai TS totali è minore rispetto agli impianti 2 e 4 (Tabella 46). Tabella 46: Concentrazione di solidi totali e volatili per classe merceologica dei flussi in
ingresso ai pretrattamenti
Classe Mercologica TS (g/kg) TVS (g/kg) TVS/TS, % Plant 1 Frutta e Verdura 249 226 90.8 Rifiuti da cucina 340 323 95.0 Carte e Cartoni 343 312 90.9 Plastiche 475 444 93.6 Inerti 650 168 25.9 Non classificabile 320 269 83.9 Plant 2 Frutta e Verdura 171 160 93.7 Rifiuti da cucina 330 315 95.6 Carte e Cartoni 420 393 93.6 Plastiche 352 331 94.0 Inerti 514 244 47.5 Non classificabile 355 310 87.3 Plant 3 Frutta e Verdura 288 260 90.1 Rifiuti da cucina 443 399 90.0 Carte e Cartoni 411 389 94.6 Plastiche 465 422 90.9 Inerti 757 276 36.5 Non classificabile 439 286 65.1 Plant 4 Frutta e Verdura 180 164 91.1 Rifiuti da cucina 325 320 98.5 Carte e Cartoni 440 410 93.2 Plastiche 360 335 93.1 Inerti 540 230 43.6 Non classificabile 360 324 90.0 147 La percentuale di solidi volatili rispetto a quelli totali per la categoria non classificabile dell''impianto 3 risulta essere il 65%, mentre per gli altri impianti è sempre superiore all''80%. Le ragioni di ciò come già anticipato risiedono nella minor efficienza dell''approccio di raccolta adottato nel caso di studio 3, in quanto i maggiori tempi di residenza nei rispettivi contenitori di raccolta ( cassonetti centralizzati) comportano una maggiore decomposizione del rifiuto prima di raggiungere la piattaforma di trattamento, tramutandosi potenzialmente quindi in un minor recupero energetico in termini di biogas. Per quanto riguarda le altri classi merceologiche , tutte risultano avere una quota di TVS superiore al 90% dei TS, ma ovviamente la quota biodegradabile è da associarsi essenzialmente a quella proveniente dalle prime due categorie (Frutta e Verdura; Rifiuti da cucina). Dall''analisi dei flussi di scarto dalla linea di pretrattamento si evincono importanti considerazioni in merito all''efficienza di separazione e al funzionamento delle tecnologie in esame. Così come per il flussi conferiti negli impianti nelle Tabelle 47 e 48 sono riportati rispettivamente i risultati dell''analisi merceologiche e la determinazione del tenore di sostanza secca delle rispettive categorie merceologiche. Tabella 47: classificazione merceologica del flusso di scarto dalla linea di pretrattamento Impianto 1 Impianto 2 Impianto 3 Impianto 4 Classe
Merceologica
% WW % DW % WW % DW % WW % DW % WW % DW Biodegradabile 27-35 14-22 n.d n.d 25-40 15-30 9-11 7-10 Carta e Cartoni 12-15 12-15 5-15 4-8 9-16 10-15 2-5 1-3 Plastiche 25-34 35-44 78-85 78-82 20-42 32-48 82-86 73-85 Inerti 10-18 16-24 n.d n.d 15-24 21-36 1-5 2-7 Non classificabile 13-18 11-16 15-22 10-18 10-23 12-20 6-10 7-12










148 Tabella 48: Contenuto di solidi totali e volati del flusso di scarti dei pretrattamenti Classe merceoligica TS(g/kg) TVS (g/kg) TVS/TS (%) Impianto 1 Biodegradabile 233 210 90.2 Carta e Cartoni 437 344 78.6 Plastiche 539 487 90.0 Inerti 590 238 40.3 Non classificabile 434 157 36.3 Impianto 2 Biodegradabile n.d n.d n.d Carta e Cartoni 306 260 84.7 Plastiche 352 331 94.0 Inerti n.d n.d n.d Non classificabile 360 279 77.4 Impianto 3 Biodegradabile 295 260 88.1 Carta e Cartoni 390 366 94.3 Plastiche 452 402 88.1 Inerti 630 233 37.2 Non classificabile 410 280 68.3 Impianto 4 Biodegradabile 288 271 94.1 Carta e Cartoni 305 264 86.6 Plastiche 398 364 91.5 Inerti 595 250 42.0 Non classificabile 368 284 77.1
Osservando le caratteristiche del flusso di materiale di scarto (tabella 47) si evince che nonostante la frazione grigia è la componete maggiore, una considerevole frazione di materiale biodegradabile non viene intercettato dalle linee di pretrattamento. Questo è particolarmente evidente per gli impianti 1 e 3 dove più del 20% (W/W) del materiale di scarto è rappresentato da una componente ad elevata biodegradabilità ( frutta/verdura e scarti da cucina). Al contrario gli impianti 2 e 4 sembrano avere una maggiore efficienza di separazione con un contenuto di materiale putrescibile ridotto (n.d per l''impianto 2 e intorno al 10% per l''impianto 4). Vi è da sottolineare comunque che una minima componente biodegradabile nell''impianto 2 è presente all''interno delle altre classi merceologiche dalle quali non è stata possibile effettuare una separazione in fase analitica. Un'' importante considerazione in merito al funzionamento dell''Impianto 1 si evince osservando il contenuto di solidi volatili nella frazione di materiale non classificabile riportato in tabella 48. Il basso tenore di solidi volatili (36.3% dei solidi totali), evidenzia l''approccio distruttivo dell'' hydropulper in quanto genera un flusso dalla pezzatura molto ridotta caratterizzata da un''elevata frazione di inerti. Il fatto che la classe merceologica delle carte e cartoni nel flusso di scarti mostri 149 una percentuale di volatili minore ( TVS/TS 78.6%) rispetto a quella relativa alla stessa classe del flusso in ingresso (90.9%) indica che vi è adeso del materiale inerte non classificabile; inoltre che tale frazione (78.6%; vedi carta e cartoni della Tabella 48 (Impianto 1) sia più bassa rispetto a quella evidenziata dalle altre tecnologie di pretrattamento ( vedi carta e cartoni della Tabella 48 Impianti 2, 3 e 4) indica una maggiore difficolta da parte del sistema ad intercettare il flusso di materiale inerte di piccole dimensioni. Spostando l''attenzione sui flussi in uscita dai pretrattamenti (tabella 49) quindi quelli entranti nella successiva sezione di stabilizzazione biologica risulta che sia la frazione di volatili su quella dei solidi totali (circa 80%) che le concentrazioni di COD, TKN e P sono simili tra i diversi casi di studio. Le differenze maggiori riscontrate riguardano la concentrazione di solidi totali che negli impianti 2 e 4 risultano maggiori per via del fatto che i loro approcci i separazione non prevedono mescolamenti con flussi liquidi. Un ulteriore differenza riguarda la concentrazione di TKN che per gli impianti 1 e 3 risulta circa il doppio rispetto agli altri due, probabilmente dovuto al diverso tipo di substrato alla fonte. Tabella 49: caratteristiche chimico-fisiche dei flussi in uscita dai pretrattamenti. TS, g/kg TVS, g/kg TVS/TS, % COD, g/kgTS TKN, g/kgTS P, g/kgTS Impianto 1 58.4 47.3 81.0 861 43 4 Impianto 2 243.0 201.0 82.6 823 28 2 Impianto 3 63.3 50.1 79.1 792 42 3 Impianto 4 139 118 84.8 945 25 8
Infine i flussi in uscita dai pretrattamenti quindi ingresso alla successiva sezione di stabilizzazione biologica sono stati caratterizzati anche dal puto di vista della distribuzione granulometrica. Nella tabella 50 vi è riportata la distribuzione e il contenuto di solidi totali e volatili delle rispettive classi granulometriche. La tabella 50 mostra che la principale classe granulometrica in tutti gli impianti risulta essere quella inferiore ai 0.25 mm: per l''impianto 1 essa risultava superiore all''80% mentre per il resto degli impianti era inferiore al 70%. Con riferimento specifico sempre all''impianto 1 le classi granulometriche 2-3.15mm e 0.25-0.5mm hanno un contenuto di sostanza volatile ridotta e tale frazione risulta essere più bassa rispetto a quelle degli altri casi di studio. Queste differenza confermano ancora una volta l''approccio distruttivo che caratterizza l''idropolapatore rispetto alle altre tecnologie di pretrattamento. Riferendoci alla classe granulometrica più grossolana (> 3.15 mm), il mulino a coltelli (TS: 21.2%) e la pressa d''estrusione (TS: 17.8%) mostrano un contenuto maggiore di solidi totali rispetto all'' idropolpatore (TS: 10.9%) e il separatore ad umido (TS: 7.9%) 150 . Questo aspetto è legato alla completa assenza nelle linee di pretrattamento degli impianti 2 e 4 di trituratori. Per tutte le altre classi comprese tra 0.5 e 2mm, i differenti casi di studio mostrano una distribuzione molto simile mostrando una frazione di solidi sempre inferiore al 10%.
Tabella 50: distribuzione granulomentrica dei flussi in uscita dai pretrattamenti Classe granulometrica TS % TVS % TVS/TS % Plant 1 > 3.15 mm 7.9 8.7 86.5 2 to 3.15 mm 0.9 0.5 41.9 1 to 2 mm 2.4 2.6 84.0 0.5 m to 1 mm 5.5 5.8 84.5 0.25'm to 0.5 mm 0.4 0.1 20.1 < 0.25 mm 82.9 82.3 78.6 Plant 2 > 3.15 mm 17.8 19.5 90.5 2 to 3.15 mm 2.2 1.9 69.2 1 to 2 mm 3.6 3.4 78.9 0.5 m to 1 mm 3.2 3.2 82.1 0.25'm to 0.5 mm 5.3 5.6 86.8 < 0.25 mm 67.8 66.4 80.9 Plant 3 > 3.15 mm 10.9 12.4 92.5 2 to 3.15 mm 3.2 2.5 62.4 1 to 2 mm 9.8 10.8 90.3 0.5 m to 1 mm 5.9 6.3 87.1 0.25'm to 0.5 mm 6.1 7.1 95.0 < 0.25 mm 64.1 60.9 77.5 Plant 4 > 3.15 mm 20.2 23.7 93.2 2 to 3.15 mm 1.6 2.0 99.9 1 to 2 mm 6.8 7.6 89.1 0.5 m to 1 mm 6.2 7.4 94.5 0.25'm to 0.5 mm 2.2 2.6 93.9 < 0.25 mm 62.9 56.7 71.5 151
Una migliore interpretazione dei risultati mostrati in tabella 50 può essere effettuata mediante un raggruppamento delle varie classi granulometriche in tre categorie: grossolana ( > 1mm), media ( 0.25mm e 1mm) e fine (< 0.25mm) (Figura 89). Figura 89: distribuzione dei solidi totali e volatili nel flusso in uscita dai pretrattamenti Come si può vedere dalla Figura 89 l''idropolpatore porta alla formazione di frazione fine superiore di circa il 20% rispetto agli altri sistemi su base TS, dimostrando chiaramente che l''idropolpatore ha un approccio distruttivo che porta alla formazione di un quantitativo superiore di sabbie. Il fatto che la percentuale di volatili segua grosso modo la stessa distribuzione dei solidi totali indica che l''azione è distribuita uniformemente sia sulla frazione organica che su quella inerte. Per quanto riguarda gli altri sistemi di pretrattamento a bassa potenza specifica installata non si assiste a particolari differenze di distribuzione. 11,3 5,8 82,9 23,7 8,6 67,8 26 13 61 28,7 8,4 62,9 0 10 20 30 40 50 60 70 80 90 100 COARSE MIDDLE FINE T S ( %) Wet Pulper Extruder Press Wet Selection Hammer Mill 11,7 5,9 82,3 24,8 8,8 66,4 27,8 14,5 57,7 33,4 7,4 56,7 0 10 20 30 40 50 60 70 80 90 100 COARSE MIDDLE FINE T V S (%) Wet Pulper Extruder Press Wet Selection Hammer Mill 152 6 Conclusioni
Nel corso di questo studio è stata condotta un''attività sperimentale volta all''ottimizzazione dei processi di digestione anaerobica a partire da matrici ad elevata biodegradabilità. Il piano di azione ha avuto due diversi fronti sperimentali: - Ottimizzazione del processo di digestione anaerobica della porzione biodegradabile dei rifiuti solidi urbani (FORSU) proveniente da raccolta differenziata. - Ottimizzazione del processo di co-digestione anaerobica di matrici tipiche del settore zootecnico/agroindustriale. Produzione di bio-hythane da FORSU. Nella sperimentazione relativa all''ottimizzazione del processo di produzione di bio- hythane è stato evidenziato che le migliori prestazioni in riferimento alla qualità e alla quantità di gas totale prodotto sono state ottenute nelle condizioni operative mostrate in Tabella 51 . Tabella 51: Condizioni operative ottimali per la produzione di bio-hythane Parametro Dark Fermentation Metanogenesi T (°C) 55 55 HRT (d) 3.3 12.6 OLR (kgTVS/m 3 rd) 16 4.2 R (QTOT/QR) 0 - 0.5 - Il controllo dinamico della portata di ricircolo della fase liquida proveniente dal reattore di metanogenesi ha consentito di mantenere il pH in un intervallo ottimale per il corretto svolgimento delle reazioni catalizzate dalle idrogenasi e nello stesso tempo ha evitato che l''ammoniaca , fattore chiave per la stabilità di processo, raggiugesse i livelli di inibizione dei processi di biogassificazione. Le correlazioni sperimentali evidenziate tra la conducibilità e altri parametri di stabilità hanno messo alla luce la possibilità di implementare un sistema di controllo on line dell''intero processo facilmente applicabile su scala industriale. L''utilizzo del ricircolo come buffer di reazione consente di ridurre al 153 minimo o addirittura annullare l''apporto di alcalinità esterna creando quindi una condizione ideale per il trasferimento del processo su sala industriale. Nel momento in cui è stato simulato un sistema di controllo automatico del processo, l''SGP totale media di bio- hythane è stata di 0.65m 3/kgTVS con una GPR pari a circa 2.6 m3/m3 rd. La composizione ha fatto registrare contenuti medi di H2, CH4 e CO2 rispettivamente del 8%, 53% e 38%. Sebbene le rese più alte ottenute sono leggermente inferiori rispetto a quelle raggiunte in altre sperimentazioni, questo rappresenta l''unico caso dove la produzione di bio-hythane è stata testata in assenza totale di interventi esterni, con un substrato reale e in reattori pilota di grossa taglia, quindi in condizioni fluidodinamiche comparabili con quelle dei reattori su scala industriale. Confronto di diversi sistemi di pretrattamento meccanico della FORSU Sempre restando nell''ambito del trattamento della porzione biodegradabile dei rifiuti solidi civili, sono state confrontate diverse tecnologie di pretrattamento meccanico della FORSU. Nell''ambito di tale studio è stato possibile stabilire che i livelli odierni di raccolta differenziata non giustificano l''installazione di sistemi di pretrattamento ad alto consumo energetico. L''analisi granulometrica sui flussi in uscita dai pretrattamenti ha stabilito chiaramente che rispetto a sistemi di trattamento più ''blandi'' (a basso consumo energetico) tali approcci portano alla formazione di una quantità superiore di materiale classificabile come sabbie, richiedendo quindi un maggiore di interventi di manutenzione a valle del sistema di pretrattamento ( maggiori costi di manutenzione). Digestione anaerobica di matrici agroindustriali Per quanto riguarda il settore agroindustriale la sperimentazione ha visto l''utilizzo in parallelo di quattro reattori pilota di grossa taglia mantenuti in diverse condizioni operative in termini di temperatura, carico organico, tempo di residenza idraulico e composizione dell''alimento. I risultati hanno messo in evidenza che l''utilizzo di residui dell''industria agroalimentare in luogo di colture dedicate consente un aumento delle rese in biogas in tutte le condizioni operative testate. Il regime termico termofilo (55°C) si è dimostrato più conveniente rispetto a quello mesofilo (37°C), eccetto nel caso del trattamento di soli effluenti d''allevamento dove l''ammonica libera ha portato a fenomeni di sbilanciamento della catena trofica anaerobica. Le più alte rese specifiche (0.54m 3/kgTVS) sono state raggiunte ad carico organico di circa 2 kgTVS/m 3d, un HRT di 60d e alla temperatura di 55°C. In questa condizione operativa il carico organico in termini VS era composto da: 154 50% effluenti d''allevamento bovino (Liquame/Letame 1.5:5), 25% colture dedicate (insilato di mais) e 25% residui vegetali dell''industria agroalimentare (patate, cipolle, radicchio). La sostituzione di colture dedicate con residui dei processi produttivi agroalimentari rappresenta una condizione favorevole non solo dal punto di vista delle rese, ma anche per quanto riguarda la qualità degli effluenti anaerobici generati in riferimento al più basso contenuto di azoto ammoniacalei. Infine non sono state riscontrate particolari differenze sia in termini di resa che di stabilità del processo tra alto (4 kgTVS/m 3 rd) e il basso carico (2 kgTVS/m 3 rd). Tale aspetto si traduce nella possibilità di poter dimezzare in fase di progettazione le volumetrie dei digestori anaerobici riducendo quindi i costi di investimento.





























155









156 Bibliografia

Alfano V. e Gaeta M., 2010. Rifiuti organici e scarti di macellazione per il biogas.
L''informatore agrario 17/2010.

Amann 2005. Fluorescently labelled, rRNA-targeted oligonucleotide probes in the study
of microbial ecology. Molecular Ecology 1995,4,543-554

Angelidaky, I. and Aharing, B.K., 1994. Anaerobic thermophilic digestion of manure at
different ammonia loads: effect of temperature digestion. Water Res. 28 (3), 727-731.

Angelidaki I. and Ellerganrd., 2003. Codigestion of manure and organic wastes in
centralized biogas plants. Applied Biochemistry and Biotechnology. Volume 109, Issue 1-
3, pp 95-105

Angelidaki, I., Alves, M.M., Bolzonella, D., Borzacconi, L., Campos, J.L, Guwy, A.J.,
Kalyuzhnyi, S., Jenicek, P. Lier, J. B. van., 2009. Defining the biomethane potential
(BMP) of solid organic wastes and energy crops : a proposed protocol for batch assays.
Water Sci. Technol. 59 (5), 927-934.

Angenent L.T. Karim K., Al '' Dahhan M.H., Wrenn B.A. Domìguez '' Espinosa R., 2004.
''Production of bioenergy and biochemicals from industrial and agricultural wastewater''
Trends Biotechnology 22(9), 477 '' 485.

Antonopolou G., Gavala H.N., Skiadas I.V., Angelopoulos K., Lyberatos G., 2008.
''Biofuels generation from sweet sorghum: fermentative hydrogen production and
anaerobic digestion of remaining biomass''. Bioresources Technology, 99, 110 '' 119

APHA, AWWA and WEF (2007) Standard Methods for Examination of Waste and
Wastewater, 21 st edition. American Public Health Association, Washington, DC, USA
Banks, C.J., Zhang, Y., Jiang, Y., , Heaven, S., 2012. Trace element requirements for
stable food waste digestion at elevated ammonia concentrations. Bioresour. Technol. 104,
127-135.

A. Bernstad, L. Malmquist, C. Truedsson, J. la Cour Jansen 2012 Need for improvements
in physical pretreatment of source-separated household food waste Waste Management
July 2012

Hansen T.L.,. Jansen J.l C, Davidsson ', Christensen T. H. 2007. Effects of pre-treatment
technologies on quantity and quality of source-sorted municipal organic waste for biogas
recovery Waste Management , 2007, Pages398-405

Bolzonella, D., Cavinato, C., Fatone, F., Frison, N., Pavan, P., Cecchi, F., 2011. Anaerobic
digestion of livestock effluents, energy crops, and agro-waste: renewable energy potential
and nutrients management. ADSW&EC, Vienna 2011

Bouallagui, H., Touhami, Y., Ben Cheikh R., Hamdi, M., 2005. Bioreactor performance in anaerobic digestion of fruit and vegetable wastes. Process Biochemistry Volume 40,
Issues 3''4, 989''995 157
Cardinali-Rezende, J., Renan B. Molecular identification and dynamics of microbial
communities in reactor treating organic household waste. Appl Microbiol Biotechnol
(2009) 84:777''789

Cecchi F., Vallini G. and Mata-Alvarez J. (1990) Anaerobic digestion and composting in
an integrated strategy for managing vegetable residues from agro-industries or sorted
organic fraction of municipal solid waste Water Science and Technology 1990 Vol. 22 No.
9 pp. 33-41

Cecchi F., Battistoni P., Pavan P., Bolzonella D., Innocenti L., 2005. ''Digestione
anaerobica della frazione organica dei rifiuti solidi. Aspetti fondamentali, progettuali,
gestionali, di impatto ambientale ed integrazione con la depurazione delle acque reflue.''
APAT '' Manuali e linee guida 13.

Chou C.H., Wang C.W., Huang C.C., Lay J.J., 2008. ''Pilot study on the influence of
stirring and pH on anaerobes converting high-solid organic wastes to hydrogen.''
International Journal of hydrogen energy. 33, 1550 '' 1558.

Chu C.F., Li Y.Y., Xu K.Q., Ebie Y., Inamori Y., Kong H.N. (2008) A pH-temperature ''
phased two-stage process for hydrogen and methane production from food waste.
International journal of hydrogen energy, 33, 4739-4746.
Climenhaga MA, Banks CJ., 2008. Uncoupling of liquid and solid retention times in
anaerobic digestion of catering wastes. Water Sci Technol. 2008;58(8):1581-7.
Colonna N., Alfano V., 2010. Quanto biogas si può produrre in Italia. L''informatore
Agrario 11/2010

Collet C, Adler N, Schwitzgue´bel J, Pe´ringer P. Hydrogen production by Clostridium
thermolacticum during continuous fermentation of lactose. Int J Hydrogen Energy
2004;29(14): 1479-85.

Cortesi., 2010. Impatto ambientale e bilancio CO2. Master Ingegneria chimica della
depurazione delle acque e delle energie rinnovabili. 2010

De Baere L and Mattheeuws B, Anaerobic digestion in Europe: state of the art 2010. In:
ORBIT 2010, Heraklion.
De Vrije T, de Haas GG, Tan GB, Keijsers ERP, Claassen PAM (2007). Pretreatment of
Miscanthus for hydrogen production by Thermotoga elfii. Int J Hydrogen Energy 27
(11e12):1381-1390.

Doi T, Matsumoto H, Abe J, Morita S. Feasibility study on the application of rhizosphere
microflora of rice for the biohydrogen production from wasted bread. Int J Hydrogen
Energy 2009;34(4):1735-43.

ENI., 2008. L''industria energetica mondiale, Editrice compositori, 1-265 (2008)
158 ENEA., 2010. Rapporto Energia e Ambiente 2009-2010.www.enea.it

Ewan B.C.R., Allen R.W.K., 2005. ''A figure of merit assessment of the routes to
hydrogen'', International Journal of Hydrogen Energy, 30, 809 '' 819.

Forbes C, Hughes D, Fox J, Ryan P, Colleran E. 2010. High-rate anaerobic degradation of
5 and 6 carbon sugars under thermophilic and mesophilic conditions, Bioresource
Technology, 101(11), 3925-3930.

Frison 2010. Energia da biomasse umide da agroindustria: studio di alcuni caso in Veneto
e possibili ottimizzazioni. Tesi di laurea In scienze ambientali

Gavala H, Skiadas I, Ahring B. 2006. Biological hydrogen production in suspended and
attached growth anaerobic reactor systems. International Journal of Hydrogen Energy,
31(9), 1164-1175.

Gerardi M.H., 2003. The Microbiology of Anaerobic Digesters. Book. Aug.2003

Ginkel SV, Sung S, Lay J. 2001. Biohydrogen production as a function of pH and substrate
concentration. Environ Sci Technol 2001;35(24):4726-30

Guo, X. M., Trably, E., Latrille, E., Carrere, H., Steyer J.P., 2010. Hydrogen production
from agricultural waste by dark fermentation: A review. Intern. Jour. Of Hydr. Ener. 35
(2010) 10660-10673.

Gomez X., Moran A., Cuetos M.J., Sánchez ME (2006) The production of hydrogen by
dark fermentation of municipal solid waste and slaughterhouse waste: a two phase
process. Journal of power sources, 157, 727-732.

Hartmann H., Moller H.B. and Ahring B.K (2004). Efficiency of the anaerobic treatment
of the organic fraction of municipal solid waste: collection and pretreatment. Waste
Management and Research (2004) 22 (1), 35-41. Hallenbeck P.C., Ghosh D. (2009) Advances in fermentative biohydrogen production: the
way forward' Trends in Biotechnology, 27, 5, 287-297. Hallenbeck P, Ghosh D, Skonieczny M, Yargeau V. 2009. Microbiological and
engineering aspects of biohydrogen production. Indian Journal of Microbiology, 49(1),
48-59

Han S.K., Kim S.H., Kim H.W., Shin H.S. (2005) Pilot-scale two-stage process: a
combination of acidogenic hydrogenesis and methanogenesis. Water Science &
Technology, 52, 1-2, 131-138.

Hanegraaf, M.C., Biewinga, E.E., Van der Bijl, G., 1998. Assessing the ecological and
economic sustainability of energy crops. Biomass Bioenerg. 15 (4/5), 345''355.

Hansen T.L,Jansen J.l.C,Davidsson A., Højlund T. Christensen Effects of pre-treatment
technologies on quantity and quality of source-sorted municipal organic waste for biogas
recovery Waste Management, Volume 27, Issue 3, 2007, Pages 398-405 159


Hawkes F, Hussy I, Kyazze G, Dinsdale R, Hawkes D, 2007. Continuous dark
fermentative hydrogen production by mesophilic microflora: Principles and progress.
International Journal of Hydrogen Energy, 32(2), 172-184.

Holm-Nielsen J.B. Al Seadi, T Oleskowicz-Popiel P (2009), The future of anaerobic
digestion and biogas utilization Bioresource Technology 100 5478''5484

ISPRA 2012. Rapporto sui rifiuti solidi urbani http://www.isprambiente.gov.it/it

Ivanova G, Ra´khely G, Kova'' KL. 2009. Thermophilic biohydrogen production from
energy plants by Caldicellulosiruptor saccharolyticus and comparison with related studies.
Int J Hydrogen Energy;34(9):3659-70.

Karlsson A, Vallin L, Ejlertsson J. Effects of temperature, hydraulic retention time and
hydrogen extraction rate on hydrogen production from the fermentation of food industry
residues and manure. Int J Hydrogen Energy 2008; 33(3):953-62.

Kataoka N., Ayame S., Miya A., Ueno Y., Oshita N., Tsukahara K., Sawayama S., Yokota
N. (2005) Studies on hydrogen-methane fermentation process for treating garbage and
waste paper. ADSW 2005 Conference Proceedings, 2, Process Engineering.

Kelessidis A., Stasinakis A.S., (2012) Comparative study of the methods used for
treatment and final disposal of sewage sludge in European countries. Waste Management.
Volume 32, Issue 6, Pages 1186''1195

Kim SH, Han SK, Shin HS. (2004). Feasibility of biohydrogen production by anaerobic
co-digestion of food waste and sewage sludge. Int J Hydrogen Energy 2004;29(15):1607-
16.

Kim J, Kim Y, Ryu J, Song B, Kim I, Yeom S. 2005. Immobilization methods for
continuous hydrogen gas production biofilm formation versus granulation. Process
Biochemistry, 40(3), 1331-1337.

Kim S, Han S, Shin H.2006 Effect of substrate concentration on hydrogen production and
16s rDNA-based analysis of the microbial community in a continuous fermenter. Process
Biochem 2006;41(1):199e207.


Kim J, Kim Y, Yeom S, Song B, Kim I. 2006. Enhancing continuous hydrogen gas
production by the addition of nitrate into an anaerobic reactor. Process Biochemistry,
41(5), 1208-1212.

Kim. S.H., Shin H.S., 2008a. ''Effects of base-pretreatment on continuous enriched culture
for hydrogen production from food waste.'' International journal of hydrogen energy. 33,
5266 '' 5274.
160 Kim S.H., Han S.K., Shin H.K., 2008b. ''Optimization of continuous hydrogen
fermentation of food waste as a function of solid retention time independent of hydraulic
retention time.'' Process biochemistry, 43, 213 '' 218.

Kyazze G, Dinsdale R, Guwy A, Hawkes F, Premier G, Hawkes D. 2007. Performance
characteristics of a two-stage dark fermentative system producing hydrogen and methane
continuously. Biotechnology and Bioengineering, 97(4), 759-770.

Klell M, Eichlseder H., Sartory M. 2012. Mixtures of hydrogen and methane in the
internal. In press 2102 combustion engine e Synergies, potential and regulations

Kraemer J.T., Bagley D.M., 2007. ''Improving the yield from fermentative hydrogen
production'' Biotechnol Lett. 29, 685 '' 695.

Kristensen M.B, Jørnsgård B. and Uellendahl H., 2011 Documentation and energy yield
optimisation of AIKAN® - a two-stage biogas technology for the organic fraction of
municipal solid waste '' biogas potential and efficiency. ADSW&EC, Vienna 2011

Kobayashi T., Xu K.Q, Li Y.Y, Inamori Y. 2012. Effect of sludge recirculation on
characteristics of hydrogen production in a two-stage hydrogenemethane fermentation
process treating food wastes. International journal of hydrogen energy 37 (2012) 5602-
5611

Kotsopoulos T, Zeng R, Angelidaki, I. 2006. Biohydrogen Production in granular up-flow
anaerobic sludge blanket (UASB) reactors with mixed cultures under hyper-thermophilic
temperature (70ºC). Biotechnology and Bioengineering, 4(2): 296-302. Kumar N, Das D. 2001. Continuous hydrogen production by immobilized Enterobacter
cloacae IIT-BT 08 using lignocellulosic materials as solid matrices. Enzyme and
Microbial Technology, 29(4-5), 280-287 Lee D.Y., Ebie Y., Xu K.Q., Li Y.Y., Inamori Y. (2010) Continuous H2 and CH4
production from high-solid food waste in the two-stage thermophilic fermentation process
with the recirculation of digester sludge. Bioresource Technology, 101, S42-S47. Lehtomaki, A., 2006. Biogas production from energy crops and crop residues. Academic
dissertation, University of Jyvaskyla, Finland.

Levin D.B., Pitt L., Love M., 2004. ''Biohydrogen production: prospects and limitations to
practical application'', International Journal of Hydrogen Energy 29,173 '' 185. Li C, Fang HHP.2007 Fermentative hydrogen production from wastewater and solid
wastes by mixed cultures. Crit Rev Environ Sci Technol 2007;37(1):1-39.

Liu D., Liu D., Zeng R.J., Angelidaki I. (2006) Hydrogen and methane production from
household solid waste in the two stage fermentation process. Water Research 40, 2230-
2236.
161 Levin DB, Islam R, Cicek N, Sparling R 2006. Hydrogen production by Clostridium
thermocellum 27405 from cellulosic biomass substrates. Int J Hydrogen Energy
;31(11):1496-503.

Liu D., Liu D., Zeng R.J., Angelidaki I. (2006) Hydrogen and methane production from
household solid waste in the two stage fermentation process. Water Research 40, 2230-
2236.

Lo Y, Lee K, Lin P, Chang, J. 2009. Bioreactors configured with distributors and carriers
enhance the performance of continuous dark hydrogen fermentation. Bioresource
Technology, 100, 4381-4387.

Martìnez-Pérez N., Cherryman S.J., Premier G.C., Dinsdale R.M., Hawkes D.L, Hawkes
F.R., Kyazze G., Guwy A.J., 2007. ''The potential for hydrogen-enriched biogas
production from crops: Scenarios in the UK'' Biomass & Bioenergy, 31, 95 '' 104

Mata-Alvarez J. Macé S. and Llabrés P. (2000) Anaerobic digestion of organic solid
wastes. An overview of research achievements and perspectives. Bioresource Technology
Volume 74, Issue 1, August 2000, Pages 3-16 Mathews J., Wang G., 2009. ''Metabolic pathway engineering for enhanced biohydrogen
production'', International Journal of Hydrogen Energy 34, 7404 '' 7416. Mezzadri 2011; Digestione anaerobica di effluenti di allevamento e gestione del digestato
funzionale alla direttiva nitrati. Carbonera, TREVISO '' 21 Ottobre 2011

Midilli, A, M. Ay, I. Dincer and M. A. Rosen. "On hydrogen and hydrogen energy
strategies: I: current status and needs", Renewable and Sustainable Energy Reviews, 9(3),
255-271 (2005) Mosey F. E and Fernandes X. A., 1989. Patterns of Hydrogen in Biogas from the
Anaerobic Digestion of Milk-Sugars. Water Science & Technology Vol 21 No 4-5 pp 187''
196

MODECOM TM A Method for Characterization of Domestic Waste ADEME Editions, Paris 1998 Müller, J., Lehne, G., Schwedes, J., Battenberg, S., Näveke, R., Kopp, J., Dichtl, N.,
Scheminski, A., Krull, R. and Hempel, D. C. (1998) Disintegration of sewage sludges and
influence on anaerobic digestion. Wat. Sci. Tech., 38(8/9), 425''433

Muyzer et al., 2007 Profiling of complex microbial populations by denaturing gradient gel
electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S
rRNA. Appl. Environ. Microbiol. March 1993 vol. 59 no. 3 695-700

Neiva Correia, C., F. Vaz, and A. Torres. "Anaerobic digestion of biodegradable waste''
operational and stability parameters for stability control." Proceedings of the V Internat.
Symposium on Anaerobic Digestion of Solid Wastes and Energy Crops. Hammamet, May
25. Vol. 28. 2008.
162 Nielsen H. B, Mladenovska Z., Westermann P., Ahring B. K. (2004) Comparison of two-
stage thermophilic (68°C/55°C) anaerobic digestion with one-stage thermophilic (55°C)
digestion of cattle manure. Biotechnology and Bioengineering Volume 86, Issue 3, pages
291''300, 5 May 2004
Nielsen, H.B,. Uellendahl, H., Ahring, B.K., 2007. Regulation and optimization of the
biogas process: Propionate as a key parameter. Biomass Bioenerg. 31 (11''12), 820'' 830

O-Thong S, Prasertsan P, Karakashev D, Angelidaki I. Thermophilic fermentative
hydrogen production by the newly isolated Thermoanaerobacterium thermosaccharolyticum PSU-2. Int J Hydrogen Energy 2008;33(4):1204-14

Pain, B. F. & Hepherd, R. Q. 1985. Anaerobic digestion of livestock wastes. In: Anaerobic
Digestion of Farm Waste, NIRD Technical Bulletins, pp 9''14

Palmosky L.M. and Müller J.A (2000). Influence of the size reduction of organic waste on
their anaerobic digestion. Water Science Technology 41 (3) pp 155-162 Parawira W, Murto M, Zvauya R, Mattiasson B. 2006. Comparative performance of a
UASB reactor and an anaerobic packed-bed reactor when treating potato waste leachate.
Renewable Energy, 31(6), 893-903.

Parawira W., Murto M., . Read J. S and Mattiasson B., 2007. A Study of Two-Stage
Anaerobic Digestion of Solid Potato Waste using Reactors under Mesophilic and
Thermophilic Conditions. Environmental Technology. Volume 28, Issue 11, 2007 Piccinini (2011), La produzione di biogas nel settore agricolo in Italia, Agriregionieuropa,
7- 24

Pohland, F.G., Ghosh, S., 1971. "Developments in anaerobic stabilization of organic
wastes: The two phase concept." Enviromental Letters, 1, 255 '' 266.

Porpatham, E., Ramesh A., Nagalingam B., 2007. ''Effect of hydrogen addition on the
performance of a biogas fuelled spark ignition engine''. International Journal of Hydrogen
Energy 32, 2057 '' 2065.

Procházka, J., Dolejš, P., Máca J., Dohányos M., 2012. Stability and inhibition of
anaerobic processes caused by insufficiency or excess of ammonia nitrogen. Appl
Microbol Biot., 93 (1), 439-447.

G Provolo, L Martínez-Sulle 2007 In situ determination of slurry nutrient content by
electrical conductivity. Bioresource technology Volume 98, Issue 17, December 2007,
Pages 3235''3242

Reith, J. H.; Wijffels, R. H.; Barten, H. 2003. Bio-methane and bio-hydrogen: status and
perspectives of biological methane and hydrogen production. Dutch Biological Hydrogen
Foundation

Ritzkowsky M, Heerenklage J, Stegmann R.(2006) An overview on techniques and
regulations of mechanical-biological pre-tratment of municipal solid waste. Environmental
Biotechnology 2 (2) 2006, 57-68 163 Rakopoulos C.D., Michos C.N. (2009). Generation of combustion irreversibilities in a
spark ignition engine under biogas-hydrogen mixtures fueling. International journal of
hydrogen energy, 34, 4422-4437.

Rivier D.,, Desvignes V., Pelletier E., Chaussonnerie S.,, Guermazi S., Weissenbach J., Li
T., , Camachoand P., Sghir A., Towards the definition of a core of microorganisms
involved in anaerobic digestion of sludge. The ISME Journal (2009) 3, 700''714 Saitou and Nai 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol (1987) 4 (4): 406-425.

Salerno M.B., Park W., Zuo Y., Logan B.E., 2006. ''Inhibition of biohydrogen production
by ammonia.'' Water Research 40, 1167 '' 1172.

Shin H.S., Youn J.H. (2005) Conversion into hydrogen by thermophilic acidogenesis.
Biodegradation, 16, 33-44. Spagni A., Buday J. , Ratini P.,Bortone G., Experimental considerations on monitoring
ORP, pH, conductivity and dissolved oxygen in nitrogen and phosphorus biological
removal processes World water congress N o1vol. 43, no 11, pp. 197-204.
Steinfeld H, Gerber P, Wassenaar T, Castel V, Rosales M, de Haan C (2006) Livestock''s
long shadow. Environmental issues and options. Food and Agriculture Organization of the
United Nations, Rome

Stronach S.M., Rudd, T., and Lester J.N., (1986). Anaerobic Digestion Processes in
Industrial Wastewater Treatment. Springer-Verlag, Berlin Heidelberg, Germany

Temudo MF, Kleerebezem R, Loosdrecht MV. 2007. Influence of the pH on (open) mixed
culture fermentation of glucose: a chemostat study. Biotechnol Bioeng 2007;98(1):69e79.

Ueno Y., Fukui H., Goto M., 2007a. ''Operation of a two stage fermentation process
producing Hydrogen and methane from organic waste.'' Environmental Science and
Technology, 41, 1413 '' 1419.

Ueno Y., Tatara M., Fukui H., Makiuchi T., Goto M., Sode K., 2007b. ''Production of
Hydrogen and methane from organic solid wastes by phase-separation in anaerobic
process.'' Bioresources Technology , 98, 1861 '' 1865.

Valdez '' Vazquez I., Poggi-Varaldo H.M. 2009. ''Hydrogen production by fermentative
consortia'' Renewable and sustainable energy Reviews 13, 1000 '' 1113.

Vancanneyt M, De Vos P, Vennens L, De Ley J. Lactate and ethanol dehydrogenase
activities in continuous cultures of Clostridium thermosaccharolyticum LMG 6564. J Gen
Microbiol 1990;136(10):1945-51.

Van Niel EWJ, Budde MAW, de Haas GG, van der Wal FJ, Claassen PAM, Stams AJM.
Distinctive properties of high hydrogen producing extreme thermophiles, Caldicellulosiruptor saccharolyticus and Thermotoga elfii. Int J Hydrogen Energy
2002;27(11e12):1391-8.
164 Velis C. A., Longhurst P. J., Drew G. H., Smith R. and Pollard S. J. T. Production and
Quality Assurance of Solid Recovered Fuels Using Mechanical''Biological Treatment
(MBT) of Waste: A Comprehensive Assessment. Critical Reviews in Environmental
Science and Technology. 40:979''1105, 2010 Venetsaneas N, Antonopoulou G, Stamatelatou K, Kornaros M, Lyberatos G. 2009. Using
cheese whey for hydrogen and methane generation in a two-stage continuous process with
alternative pH controlling approaches. Bioresoure Technology, 100(15), 3713-3717

Vavlin, V.A., 2010. Anaerobic Degradation of Organic Waste: An Experience in
Mathematical Modeling. Microbiology., 79 (3), 352''359.

Wang X., Zhao Y.C. (2009) A bench scale study of fermentative hydrogen and methane
production from food waste in integrated two-stage process. International journal of
hydrogen energy, 43, 245-254.

Ward, A.J., Hobbs, P.J., Holliman, P.J., Jones, J.L., 2008. Optimisation of the anaerobic
digestion of agricultural resources. Bioresour. Technol. 99, 7928''7940

Weiland Peter (2010) Biogas production: current state and perspectives Appl Microbiol
Biotechnol 85:849''860.

Wiegel J, Kuk S, Kohring GW. Clostridium thermobutyricum sp. nov., a moderate
thermophile isolated from a cellulolytic culture, that produces butyrate as the major
product. Int J Syst Bacteriol 1989;39(2):199e204.

Wiegant, W.M., Zeeman, G., 1986. The mechanism of ammonia inhibition in the
thermophilic digestion of livestock wastes. Agr. Wastes. 16 (4), 243''25

Wu SY, Lin CY, Lee KS, Hung CH, Chang JS, Lin PJ, Chang FY. 2008. Dark
fermentative hydrogen production from xylose in different bioreactors using sewage
sludge microflora. Energy and Fuels, 22, 113-119.
Xin Mei Guao, Eric Trably, Eric Latrille, Hèlene Carrère, Jean-Philippe Steyer, 2010.
Hydrogen production from agricultural waste by dark fermentation. International Journal
of Hydron energy 35, 10660-10673. Zhang Z, Show K, Tay J, Liang D, Lee D. 2008. Enhanced continuous biohydrogen
production by immobilized anaerobic microflora. Energy Fuels, 22(1), 87-92.
Zhu H., Stadnyk A., Bèland M., Seto P. (2008) Co-production of hydrogen and methane
from potato waste using a two-stage anaerobic digestion process. Bioresource Technology,
99 (11), 5078-5084.
165 Yokoyama H, Waki M, Moriya N, Yasuda T, Tanaka Y, Haga K. Effect of fermentation
temperature on hydrogen production from cow waste slurry by using anaerobic microflora
within the slurry. Appl Microbiol Biotechnol 2007;74(2):474-83


Ye NF, Lu F, Shao LM, Godon JJ, He PJ (2007). Bacterial community dynamics and
product distribution during pH-adjusted fermentation of vegetable wastes. J Appl
Microbiol;103 (4):1055e65.









































166 Appendice 1: Aspetti cinetici della digestione anaerobica.

Le prime fasi del processo di digestione anaerobica sono governate da cinetiche di primo ordine (equazione 1). Alte concentrazioni di substrato corrispondono ad alte velocità di consumo dello stesso, con conseguente accumulo nel mezzo dei prodotti di tali reazioni. Equazione 1 : Rxs = -KS Rxs = velocità specifica di consumo del substrato (massa volume -1tempo -1) K= massima velocità specifica di idrolisi (tempo -1) S= concentrazione di substrato (massa volume -1) La velocità di crescita dei microrganismi acidogeni è data da: Equazione 2 :  = velocità di crescita dei microrganismi per una data concentrazione di substrato (tempo'' 1);  max= massima velocità di crescita dei microrganismi,(tempo ''1 ); S = concentrazione del substrato a contatto con i microrganismi, (massa volume -1); KS=, coefficiente di semisaturazione (massa volume -1); kd = coefficiente di decadimento dei microrganismi, (tempo -1) Nell''equazione 2, il rapporto S / (Ks + S) tende ad 1 ad alte concentrazioni di substrato S e la cinetica di crescita di microrganismi può essere approssimata ad una cinetica di primo ordine. Il processo di metanogenesi ad opera dei batteri acetoclasti è ben simulato da una cinetica di Monod che può essere soggetta ad un''inibizione da substrato (ad esempio eccesso di acetato nel mezzo). La relazione di Monod nel caso di inibizione assume la forma analitica di: Equazione 3 : [Acetoclasti] I = alla concentrazione di inibente (massa volume) d _ S MAX k S K S μ μ ' ' '  ' ' '  S IKi K S u u s ' ' ' 1 max 167 Ki = coefficiente di semisaturazione, corrispondente alla concentrazione di inibente I, in corrispondenza della quale la velocità di utilizzo del substrato per unità di massa dei microrganismi è pari alla metà della velocità massima (massa volume -1) Il processo di metanogenesi operato dai batteri idrogenotrofi è del tipo di Monod a due substrati, S1 e S2 (equazione 4), che rappresentano, rispettivamente, la concentrazione di idrogeno e di biossido di carbonio: Equazione 4 : [Idrogenotrofi] S1= concentrazione dell''idrogeno a contatto con i microrganismi, [massa volume -1]; S2=concentrazione del biossido di carbonio a contatto con i microrganismi, [massa volume - 1]; KS1= coefficiente di semisaturazione, corrispondente alla concentrazione di substrato S1, alla quale la velocità di utilizzo del substrato per unità di massa di microrganismi è pari alla metà della velocità massima, [massa volume -1]. KS2=, coefficiente di semisaturazione, corrispondente alla concentrazione di substrato S2, alla quale la velocità di utilizzo del substrato per unità di massa di microrganismi è pari alla metà della velocità massima, [massa volume -1].























2 S2 2 1 S1 1 MAX S K S S K S μ μ ' ' ' 168 RINGRAZIAMENTI
Giunto al termine di questa esperienza formativa desidero ringraziare tutti coloro che
direttamente o indirettamente hanno contribuito alla realizzazione di questo lavoro.

Ovviamente il mio primo ringraziamento va al Prof. Paolo Pavan che mi ha dato la
possibilità di intraprendere questo percorso lungo tre anni. Lo ringrazio vivamente per tutti
i preziosi suggerimenti che mi ha dato (anche per quelli che non mi ha dato), per la fiducia
ricevuta e soprattutto per il tipo di rapporto che siamo riusciti ad instaurare dal primo
momento che ho messo piede a Treviso. Grazie Prof!

Con lui voglio ringraziare tutto il gruppo di ricerca dell''Università di Venezia e in modo
particolare Matteo Borin, Marco Gottardo e Federico Micolucci ossia i tesisti che ho avuto
la fortuna di seguire in questi anni. Il loro è stato un importantissimo contributo senza il
quale sarebbe stato veramente difficile portare a termine con successo il mio lavoro.


Grazie a tutto il gruppo dell''università di Verona e in modo particolare David il quale con
grandissima professionalità mi ha seguito praticamente in tutti i momenti della mia attività
sperimentale. I suoi suggerimenti e le sue osservazioni sono il bagaglio più prezioso che mi
porterò dietro in ambito professionale.

Come posso dimenticare Paolino' Anzi ora che ci penso sono i suoi gli insegnamenti più
preziosi. Quindi, David declassato! Grazie mille Paolino! Dovrebbero tutti prendere
esempio da te. Senza la tua baracca si dovrebbe chiudere il resto della baracca!

Un grazie infinito va a Silvia cronista silenziosa di tutte le mie emozioni. Se sono finito a
fare il dottorato a Venezia è stata solo per una grande coincidenza (che ha cambiato
completamente la mia vita) di cui lei è stata protagonista: '' Scusa ma sei tu Silvia
Lampis''''

Ora come la prassi vuole dovrei ringraziare non so quante altre persone (il ricercatore,
l''assegnista, quello che un giorno è passato dal laboratori e ti ha salutato, il benzinaio sulla
tangenziale, la padrona di casa, la barista, il vendidore delle casse di radicchio a 3 euro al
kilo, il kebabaro, gente dall''idendità indecifrata'insomma tutti così come fanno tutti!) per
poi concludere con i miei genitori. Ma non lo faccio perché sono circa le quattro del
mattino. Dovevo caricare la tesi sul sito dell''università ormai qualche ora fa. Come al
solito mi riduco all''ultimo momento nel fare le cose, anzi spesso, come in questo caso,
''sforo'' i limiti. Meno male che in segreteria a Santa Marta c''è Nicola Miotello (''A Nicò
con quest''altra richiesta che ti dovrò fare mi sa che ti devo ettolitri di spritz '''). E con il
ringraziare proprio lui, l''uomo dalla mail dottorati.dais@unive.it, per l''imbeccabile lavoro
che ha condotto in questi anni che passo, chiudo e ''vaiu e mi curcu ca domane si fhatiga!''



Bologna 01/02/2013 Ore 3:53 169
Studente: Antonio Giuiano Matricola: 955760 Dottorato: Scienze Ambientali Ciclo: XXV Titolo della tesi: Ottimizzazione dei processi di digestione anaerobica di matrici ad
elevata biodegradabilità Riassunto
Il lavoro di dottorato si inquadra nell''ambito delle energie da fonti rinnovabili, ed in particolare in quello del recupero di combustibili gassosi da matrici ad alta biodegradabilità. I filoni affrontati sono due: da una parte, la messa a punto di un sistema integrato AD a 2 fasi per il trattamento di FORSU, al fine di produrre biohythane, controllando il sistema attraverso il flusso di ricircolo da una fase all''altra. L''altro filone invece ha riguardato l''ambito agroindustriale, nell''ottica di definire le migliori condizioni operative per matrici di origine zootecnica ed agricola. I risultati ottenuti sono stati notevoli sotto molteplici aspetti: le rese di conversione sono state elevate, la produzione di idrogeno si è rivelata in linea con le necessità di formare una miscela gassosa di interesse industriale e le possibilità offerte dal controllo sulla linea di ricircolo aprono la strada a possibili implementazioni di un controllo di processo on line basato su sonde a basso costo. Abstract The present Ph.D thesis is focused on the energy production from renewable resources. In particular it deals with the gaseous biofuels recovery from high biodegradable waste streams. Two studies has been carried out. The first one deals with the optimization of a two-phase anaerobic digestion process treating the OFMSW for bio-hythane production through reject water recirculation. The second study is focused on the anaerobic co- digestion process treating biowaste from agro-food industry ( manure, energy crops and agro-waste) in order to define the better operating conditions. The results shows that high biogas yields can be achieved. Moreover a stable bio-hythane production was obtained and the overall process can be implemented with a low cost automatic control system.


© Eiom - All rights Reserved     P.IVA 00850640186